Hello, is there a tool for processing the blast output and perform a statistical analysis of the alignment? For example a plot of the position of the mismatches? I cant believe that there is no existing tool. Here is a example of my blast output:
>ref|NC_018914.1| Homo sapiens chromosome 3, alternate assembly CHM1_1.0, whole
genome shotgun sequence
gb|CM001611.1| Homo sapiens cell-line CHM1htert chromosome 3, whole genome shotgun
sequence
Length=197815086
Score = 54.0 bits (27), Expect = 3e-05
Identities = 33/35 (94%), Gaps = 0/35 (0%)
Strand=Plus/Minus
Query 1 CTAGAATGCACACTCCTACCTCCTTTACCAAACGT 35
|||||||||||| |||||| |||||||||||||||
Sbjct 169676496 CTAGAATGCACATTCCTACTTCCTTTACCAAACGT 169676462
•
written
by
pmuench •
4 answers
Unfortunately, this answer is incorrect (even though it received most votes) given the task to identify location of indels and mismatches. The tabular output format does not convey this information. Sorry, I missed this in the first place.
Depending on the language you are working in, you might search your favorite search engine on "[language] blast parser".
I think this is a bit general to be helpful.
As a general matter, when the person asking a question narrows down the scope of the question, that generally allows more focused answers. Cheers.
I agree with Gaik Tamazian that you probably need a tabular output, although other format can be parsed, too, with a bit more tricks of text manipulation. I used to write a Perl script to retrieve the sequence alignment directly, instead of tabular output. Here are some tricks I can share with you:
In addition to standalone blast (as Gaik Tamazian showed to you), I suggest the directly http way, in which you don't need to download the whole GenBank to your computer. Simply type these web addresses in your browser manually or automatically using any language:
Blast a sequence:
Get tabular output:
Get multiple (not pairwise) sequence alignment
You will see your results instantly.
This answer is incorrect given the requirement to retrieve detailed alignment information and addresses a different topic (remote blast) than the one described in the question.
BioPerl is the tool of choice when it comes dealing with more refined dissection of Blast results. See http://www.bioperl.org/wiki/HOWTO:SearchIO#seq_inds.28.29
for a code example. This example shows exactly what you want to do using the method seq_inds() of a HSP object.
Ignore other answers directing to tabular output formats, they are misleading. While tabular format is easier to parse and useful under certain conditions, the location of mismatches and indels can certainly not be derived from tabular blast format (6), but only from either standard format (0), XML, or ASN which contain the homology string.
Log in to answer this question.
Sorry for the late answer, just saw this was put to the top automatically, are you still bearing with us?
One could also say that the standard output already is the perfect report, it provides all required information including the E-value (statistical analysis).