This is a test version of Biostars. For the public version, visit https://www.biostars.org.
The inchworm process failed. Trinity running error.

Hello everyone,

I'm trying to perform a de novo transcriptome using Trinity and having many issues. The last time I got the inchworm error attached.

********************************************************************
** Warning, Trinity cannot determine which version of Java is being used.  Version 1.7 is required.

Attempting to continue in 30 seconds
********************************************************************


Trinity version: v2.1.1
-ERROR: couldn't run the network check to confirm latest Trinity software version.

Wednesday, May 31, 2023: 13:16:33       CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/tortolas/opt/trinity-2.1.1/util/support_scripts/ExitTest$Wednesday, May 31, 2023: 13:16:33       CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/tortolas/opt/trinity-2.1.1/util/support_scripts/ExitTest$

----------------------------------------------------------------------------------
-------------- Trinity Phase 1: Clustering of RNA-Seq Reads  ---------------------
----------------------------------------------------------------------------------
Converting input files. (in parallel)Wednesday, May 31, 2023: 13:16:33  CMD: cat /LUSTRE/home/BIO176/garrigosm/tortolas/trinity/../reads_norrna/all_reads_R1.fastq | fastool --illumina-trin$Wednesday, May 31, 2023: 13:16:33       CMD: cat /LUSTRE/home/BIO176/garrigosm/tortolas/trinity/../reads_norrna/all_reads_R2.fastq | fastool --illumina-trinity --to-fasta >> right.fa 2> /L$-conversion of 639072274 from FQ to FA format succeeded.
-conversion of 639072274 from FQ to FA format succeeded.
Wednesday, May 31, 2023: 13:57:22       CMD: touch left.fa.ok right.fa.ok
Wednesday, May 31, 2023: 13:57:22       CMD: cat left.fa right.fa > both.fa
-------------------------------------------
----------- Jellyfish  --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

* Running CMD: jellyfish count -t 20 -m 25 -s 18178674418  --canonical  both.fa
* Running CMD: jellyfish dump -L 1 mer_counts.jf > jellyfish.kmers.fa
* Running CMD: jellyfish histo -t 20 -o jellyfish.kmers.fa.histo mer_counts.jf

* Running CMD: /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/tortolas/opt/trinity-2.1.1/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 -L 25 --monitor 1   --DS  --nu$sh: línea 1: 3962748 Terminado (killed)      /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/tortolas/opt/trinity-2.1.1/Inchworm/bin//inchworm --kmers jellyfish.kmers.fa --run_inchworm -K 25 $Kmer length set to: 25
Min assembly length set to: 25
Monitor turned on, set to: 1
double stranded mode set
setting number of threads to: 6
-setting parallel iworm mode.
-reading Kmer occurences...
^M [0M] Kmers parsed.     ^M [1M] Kmers parsed.     ^M [2M] Kmers parsed.     ^M [2M] Kmers parsed.     ^M [3M] Kmers parsed.     ^M [3M] Kmers parsed.     ^M [4M] Kmers parsed.     ^M [5M$        Pipeliner::run(Pipeliner=HASH(0x55918cd0a9a0)) called at /home/BIO176/garrigosm/anaconda3/envs/tortolas/bin/Trinity line 2054
        eval {...} called at /home/BIO176/garrigosm/anaconda3/envs/tortolas/bin/Trinity line 2049
        main::run_inchworm("/LUSTRE/home/BIO176/garrigosm/tortolas/trinity/trinity_out_di"..., "both.fa", undef, "") called at /home/BIO176/garrigosm/anaconda3/envs/tortolas/bin/Trinity li$        main::run_Trinity() called at /home/BIO176/garrigosm/anaconda3/envs/tortolas/bin/Trinity line 1206
        eval {...} called at /home/BIO176/garrigosm/anaconda3/envs/tortolas/bin/Trinity line 1205


If it indicates bad_alloc(), then Inchworm ran out of memory.  You'll need to either reduce the size of your data set or run Trinity on a server with more memory available.

** The inchworm process failed.

The code I used is:

Trinity --seqType fq --left ../reads_norrna/all_reads_R1.fastq --right ../reads_norrna/all_reads_R2.fastq --CPU 20 --max_memory 350G --no_bowtie

Thank you in advance!

inchworm transcriptome trinity
• 2,451 views • link
updated by GenoMax GenoMax • written by Marta • Marta

This likely is the issue.

You'll need to either reduce the size of your data set or run Trinity on a server with more memory available.

trinity requires 1GB of RAM per million paired-end reads (LINK). How much data do you have?

• 0 views • link
written by GenoMax GenoMax

I have around 300k reads for each file (R1 and R2), but I also tried it with only 1 sample (15472207 reads) and also get errors. Thanks!

• 0 views • link
written by Marta • Marta

That is 15 million reads not 300K. But even then 350G of RAM should have been plenty. Your files are complete i.e have no issues with them?

• 0 views • link
written by GenoMax GenoMax

My bad, its 600 millions reads, 15-20 per sample. I meant that in this case, I run the code with all samples merged. However, using only one sample I still get errors. I checked the files before and after emerging all samples and the number of reads coincides in R1 and R2, and makes sense looking at the different fastqc I performed during the data cleaning. Files head looks like this:

@A00155:572:H2Y5JDSX5:2:1101:21856:9565 1:N:0:CACACATC
CACCGTCCCCCTTTGGGACGGAGTGGGCTCAAGGATTTTCTCAATCAGCCTCCAAACTGGCAGAAGCTTCCTTATGGTCCTGATCCACAAGAACTCGAATTGGTAGACTCCCTAAATGCCTCCTACTGCATATTCTTCCGCAGCTCAAAAG
+
FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:FFFFFFFFF:FFFFFFF:FFFF:FFFFFFFFFFFFFFF,FFFFF:FFFFFFFFFFFFFFFFFFFFFF,,FFFFFFFFFFFFF:,FFFFF:FFFF,:FF:FFFFFFF:FFFFFFFFFFF @A00155:572:H2Y5JDSX5:2:1101:22923:9565 1:N:0:CACACATC CATCTCCGAAACCTTCAACCACGCCAACGGCCTCACGCTGGTCTCCCGCGCTCACCAGCTGGTCATGGAGGGTTATAACTGGTGCCACGACCGAAACGTGGTGACCATTTTCAGCGCGCCCAATTACTGCTACCGCTGCGGAAACCAGGCT + FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF @A00155:572:H2Y5JDSX5:2:1101:25889:9565 1:N:0:CACACATC TGATTAATCAGGGTTGCTGAGGCCAGGGTTGCTGTTATGATGAATTCCACAGCACAAGCAATTTACTGGGTTTCTCTGAATTCTGGTTTCATCTCTTCATACTTCAGTGTGACTCTGGCTCTGAGACAGAGGGGATGATGCACCGGAGGAA
• 0 views • link
updated by Ram Ram • written by Marta • Marta

can you run the same command with just one sample with the flag --verbose so we can actually see the error?

• 0 views • link
written by andres.firrincieli andres.firrincieli

With a sample, the error occurs in the previous step. This is the error I get with the flag --verbose

********************************************************************
** Warning, Trinity cannot determine which version of Java is being used.  Version 1.7 is required.

Attempting to continue in 30 seconds
********************************************************************


Trinity version: v2.1.1
-ERROR: couldn't run the network check to confirm latest Trinity software version.

-since butterfly will eventually be run, lets test for proper execution of java
#######################################
Running Java Tests
Friday, June 2, 2023: 12:50:11  CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/1tortolas/opt/trinity-2.1.1/util/support_scripts/ExitTester.jar 0CMD finished (0 seconds)
Friday, June 2, 2023: 12:50:11  CMD: java -Xmx64m -XX:ParallelGCThreads=2 -jar /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/1tortolas/opt/trinity-2.1.1/util/support_scripts/ExitTester.jar 1-we properly captured the java failure status, as needed.  Looking good.
Java tests succeeded.
###################################

Friday, June 2, 2023: 12:50:12  CMD: mkdir -p /LUSTRE/home/BIO176/garrigosm/tortolas/reads_norrna/sample/trinity_out_dir
CMD finished (0 seconds)
Friday, June 2, 2023: 12:50:12  CMD: mkdir -p /LUSTRE/home/BIO176/garrigosm/tortolas/reads_norrna/sample/trinity_out_dir/chrysalis
CMD finished (0 seconds)


----------------------------------------------------------------------------------
-------------- Trinity Phase 1: Clustering of RNA-Seq Reads  ---------------------
----------------------------------------------------------------------------------

Converting input files. (in parallel)Friday, June 2, 2023: 12:50:12     CMD: cat /LUSTRE/home/BIO176/garrigosm/tortolas/reads_norrna/sample/A8_0dpi.nonrrna.1.fq | fastool --illumina-trinit$Friday, June 2, 2023: 12:50:12  CMD: cat /LUSTRE/home/BIO176/garrigosm/tortolas/reads_norrna/sample/A8_0dpi.nonrrna.1.fq | fastool --illumina-trinity --to-fasta >> right.fa 2> /LUSTRE/home$CMD finished (59 seconds)
CMD finished (59 seconds)
-conversion of 15427545 from FQ to FA format succeeded.
-conversion of 15427545 from FQ to FA format succeeded.
Friday, June 2, 2023: 12:51:15  CMD: touch left.fa.ok right.fa.ok
CMD finished (0 seconds)
Friday, June 2, 2023: 12:51:15  CMD: cat left.fa right.fa > both.fa
Done converting input files.CMD finished (4 seconds)
Friday, June 2, 2023: 12:51:19  CMD: touch both.fa.ok
CMD finished (0 seconds)
-------------------------------------------
----------- Jellyfish  --------------------
-- (building a k-mer catalog from reads) --
-------------------------------------------

* Running CMD: jellyfish count -t 20 -m 25 -s 52829896083  --canonical  both.fa
sh: línea 1: 1246783 Abortado                (`core' generado) jellyfish count -t 20 -m 25 -s 52829896083 --canonical both.fa 2> tmp.1246677.stderr
Error, cmd: jellyfish count -t 20 -m 25 -s 52829896083  --canonical  both.fa 2>tmp.1246677.stderr died with ret 34304 at /LUSTRE/home/BIO176/garrigosm/anaconda3/envs/1tortolas/opt/trinity-$        Pipeliner::run(Pipeliner=HASH(0x2cc23c0)) called at /home/BIO176/garrigosm/anaconda3/envs/1tortolas/bin/Trinity line 1988
        main::run_inchworm("/LUSTRE/home/BIO176/garrigosm/tortolas/reads_norrna/sample/tr"..., "both.fa", undef, "") called at /home/BIO176/garrigosm/anaconda3/envs/1tortolas/bin/Trinity l$        main::run_Trinity() called at /home/BIO176/garrigosm/anaconda3/envs/1tortolas/bin/Trinity line 1206
        eval {...} called at /home/BIO176/garrigosm/anaconda3/envs/1tortolas/bin/Trinity line 1205

Trinity run failed. Must investigate error above.
• 0 views • link
updated by GenoMax GenoMax • written by Marta • Marta

The initial ERROR is simply a warning so that is hopefully not the problem. What do you see when you run java --version?

died with ret 34304

Your error appears to be similar to a prior one reported here: https://github.com/trinityrnaseq/trinityrnaseq/issues/647

Based on answers there you are likely running against storage quota or some other limit.

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this