Hello, Curious to know if its possible to generate gff/gtf file using cDNA transcripts FASTA file. The purpose is to map the gene structural coordinates using the coding cDNA transcripts. Kindly suggest.
Regards, B
BLAT your cDNAs to the reference. This should be a PSL file that can be converted to a psl->gff3 converter (e.g: https://github.com/gpertea/gsrc/blob/master/scripts/psl2gff )
pierre.peterlongo Thank you. I tried BLAT but could got the following error. Any suggestion on what may have caused this.
command used: blat genome.fasta transcripts.fasta -out=psl ouput.psl
Error: Line too long (more than 536870912 chars) line 2 of genome.fasta
Regards, B
1) wrong user id. I'm not P Peterlongo
2) show us the output of
```
head -n 2 genome.fasta | cut -c 1-500
```
Thanks Pierre Lindenbaum :)
Pierre Lindenbaum Sorry about that; Here's an output for 2). The input genome looks fine to me, however, its a very large file (>3Gb). Could the error may be related to its size?
>CHR1
TATTATTTTGTGCGAAAAACTACCACTTGTGTCCTAATCCAAGGCAAAAAACTACCAAGTGT
ATAGTTGAAGCTGCACGCTGTATAAACACTCTTTCGGATGGCAAGGCAGCGGTCTGCTGACC
TGCCGACAGTGACGTGCATCTGAAATTCCAAGTGTGCAACATCCCTAGACATGATGCCACGA
TGATACTCTGGAGAATACAGTCGGGCAGCTCCTGCTCGCCCTCGAGCTCGTTCAGGTTACCA
TCGACGGGCCGGCGCCCTTGATGAGTTCCAAGAGCAGCACGCCATAATTGCAGATGTGGCCC
TCGGCTTTCTCCTGGGGTACCAGCCATATACCAATGCATTTCGTTCAGTTGCTACTTTATAA
CTTTTAAAAGTCGAGTATTTAACCAAAAACTACCACATTTCATAGAAACGAAACTATCACTT
GAAAAGTGCCCGATTTACCTCTTCTAAACGCCTTTCTTACGTGTTGGGCCCA
Log in to answer this question.
