This is a test version of Biostars. For the public version, visit https://www.biostars.org.
convert fasta/qual into fastq files via terminal linux?

How can I convert two files one fasta and one which into a single fastq file via linux terminal, if anyone can help me I'll be grateful!

linux fastq
• 2,822 views • link
updated by Ram Ram • written by Kárita • Kárita

sorry you cut the sentence, it was a .fasta file and a .qual

• 0 views • link
written by Kárita • Kárita

.fasta

>IBN2P8H01DK86M length=51 xy=1355_0556 region=1 run=R_2013_06_25_14_33_34_
GGGTGATGATCGCAACATCAGCTGTACATCGAGTAGACGTTCTGCGAACAC

.qual

>IBN2P8H01DK86M length=51 xy=1355_0556 region=1 run=R_2013_06_25_14_33_34_
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 33 33 33 33 33 40 40 40 40 40 40 40 40 40 40 40 38 35 31 29 28 31 37 34 34 25 25 18 16 16
• 0 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by Kárita • Kárita

2 answers

See: http://qiime.org/scripts/convert_fastaqual_fastq.html

• 0 views • link
written by GenoMax GenoMax

thank you, I will test it!

• 0 views • link
written by Kárita • Kárita

not tested, but it should be:

paste <(cat file1 | paste - - | sed 's/^/@/') \
          <(cat file2 | paste - - | cut -f2 )  |\
          awk -F '\t' '{printf("%s\n%s\n+\n%s\n",$1,$2,$3);}'
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

ah yes, sorry , that's too much for a saturday ! :-¨P

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

does not recognize -F command

• 0 views • link
written by Kárita • Kárita

Log in to answer this question.

More posts like this