I have annotated 500 miRNA sequences that range between 16-40 from blastout.fa file (original) using mature miRNA database and stored them in a file (myresults). Now, I would like to find the occurrence/read count of each sequence present in myresults file from blastout.fa file (original). I knew how to find the occurrence of a single sequence, but I am facing difficulties in finding the read counts of all the sequences present in a file (myresults) from blastout.fa (original). For instance, ACCGUACGACGACCGUACGACG is annotated and present in myresults file, I am able to find the readcount of this sequence in blastout.fa file, but I am facing difficulties in finding the readcounts of all the 500 sequences present in the file. Kindly suggest.
0 answers
No answers yet.
Log in to answer this question.
-
Which locus should be considered the true ortholog after liftOver disagreement between chrUn and ch…
written by jhonatan.henrique •
-
If the names of miRNAs are the same for different species, are they the same sequence?
written by Apprentice
-
How to run quantifier from miRDeep2 (miRNA seqs from MirGeneDB)
written by Apex92 •
-
Homology search of miRNA using ncbi-blast+ standalone application?
written by khq5801 •
-
How can I generate the map.txt file require to detect novel miRNA using miReap
written by khq5801 •
-
How to analyze the mirbase mature sequence aligned miRNA output file
written by khq5801 •
-
Create annotation file for mature miRNA sequences from mirBase
written by polag03 •
-
Precursor identification of mature miRNA
written by Prasad
-
How to use TCGA miRNA seq data?
written by bhoomisharma04 •
-
Iso Download Resource Showing Where Mature Mirna Sequences Are Located On Pre-Mirna Hairpins
written by Jeremy Leipzig
Please provide examples of the file content and format, besides how are you counting. It is hard to know what you have