This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Iso Download Resource Showing Where Mature Mirna Sequences Are Located On Pre-Mirna Hairpins

where can I get pre-miRNA sequences annotated in the following format:

for each hairpin sequence I need to know where the mature sequences are located, as well as these dot-bracket diagrams

hsa-let-7a-1
TGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTA
(((((.(((..((((((((((((((((...(((.....))).((....))....))))))))))))))))..))))))))
   ========================                        ==========================
mirna

1 answer

I am not aware of any such pre-calculated files. I would say the easiest way is to download the precursor structures and mature data from mirbase.org and to match and merge them yourself.

Searching the mature is a simple exact search. Reformatting the structure string and locating the star sequence will need some additional efforts.

Good luck!

I should mention that the given structures are quite ok for short precursors (such as found in animals). For long sequences of more than 100bp you should not trust them. miRBase always shows hairpins even when the loops are very large.

Considering this, I would suggest to download the precursor sequence and mature sequence. Fold the pre-miR sequence on yur own with your favourite program (RNAfold, mfold/unafold, etc.). As miR and miR* are highly complementary I am pretty much sure that you will obtain the required stem in this section without a constraint for folding.

Log in to answer this question.