This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What happened to QBlast?

After some years of inactivity I'm updating BioSmalltalk (a bioinformatics library) for Pharo with the latests changes in NCBI services. One of these services, called QBlast, seems to be no longer accessible :

http://web.archive.org/web/20090125100600/http://www.ncbi.nlm.nih.gov/BLAST/Doc/urlapi.html

Clicking around, I've arrived to this (potentially) alternative service: https://ncbi.github.io/blast-cloud/dev/api.html but it seems to be "DEPRECATED".

Anyway I tried to send a request using the QBlast API, following recommendations in this biopython thread, which would be :

BioNCBIWebBlastWrapper new nucleotide
            query: 'CCCCATGCATATAAGCAAGTACATGACCTCTATAGCAGTACATAATACATATAATTATTGACTGTACATAGTACATTATGTCAAATTCATTCTTGATAGTATATCTATTATATATTCCTTACCATTAGATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACCCGCTAGGCAGGGATCCCTCTTCTCGCTCCGGGCCCATAAACCGTGGGGGTCGCTATCCAATGAATTTTACCA';
            hitListSize: 10;
            filterLowComplexity;
            expectValue: 10;
            wordSize: 10;
            blastn;
            formatTypeXML;
            alignmentViewFlatQueryAnchoredNoIdentities;
            fetch.

This translates into:

Any idea what I should look to update?

This is the first bytes of the HTML page I get so far:

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" >
<head>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
<meta name="robots" content="index,follow" />
<meta name="verify-v1" content="6esrL4Jqlv4/2lbCRFu0SeYW5zrKD7E9U+gmGlKNtro=" />
<META NAME="keywords" CONTENT="blast,basic local alignment search tool,sequence similarity,sequence alignment,sequence homology,bioinformatics" />
<META NAME="description" CONTENT="The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. BLAST can be used to infer functional and evolutionary relationships between sequences as well as help identify members of gene families." />
<meta name="ncbitoggler" content="animation:'none'"/>
<meta name="referrer" content="origin-when-cross-origin" />
<meta name="ncbi_app" content="blast" />
<meta name="ncbi_pdid" content="blasthome" />

<meta name="ncbi_db" content="" />
<meta name="ncbi_program" content="" />
<meta name="ncbi_algorithm" content="" />

<meta name="ncbi_stat" content="false" />
<meta name="ncbi_sessionid" content="55BA32CE32961071_0000SID" />
<meta name="ncbi_phid" content="55BA32CE329610710000000000000001" />
<meta name="ncbi_pcid" content="" />
<script type="text/javascript"> var ncbi_startTime = new Date(); </script>
<title>BLAST: Basic Local Alignment Search Tool</title>
<script type="text/javascript" src="/core/jig/1.15.2/js/jig.min.js             "></script>
<script type="text/javascript">    jQuery.getScript("/core/alerts/alerts.js", function() {
        galert(['div#header', 'body > *:nth-child(1)'])
    });</script>
<meta http-equiv="Pragma" content="no-cache">
<link rel="stylesheet" type="text/css" href="css/uswds.min.css" media="screen" />
<link rel="stylesheet"  type="text/css" href="https://www.ncbi.nlm.nih.gov/style-guide/static/nwds/css/nwds.css"/>
<link rel="stylesheet" href="css/headerNew.css?v=1"/>
<link rel="stylesheet" href="https://use.fontawesome.com/releases/v5.5.0/css/all.css" crossorigin="anonymous"> <!-- Font Awesome icons -->
<link rel="stylesheet" type="text/css" href="css/footerNew.css?v=1" media="screen" />



<link rel="stylesheet" type="text/css" href="css/home.css" media="screen" />
<link rel="stylesheet" type="text/css" href="css/print.css" media="print" />
<!--[if lte IE 6]>
<link rel="stylesheet" type="text/css" href="css/ie6_or_less.css" />
<![endif]-->
<script type="text/javascript" src="js/utils.js"></script>
<script type="text/javascript" src="js/blast.js"></script>
<script type="text/javascript" src="js/remote_data_provider.js"></script>
<script type="text/javascript" src="js/home.js"></script>
<script type="text/javascript" src="js/blastSurvey.js"></script>
<meta name="google-site-verification" content="DNp69-s7ILfn5FWNLN_xE4zVhpY0dDtLrLyOB_WOzpA" />
</head>
<body id="type-d">
<!--<div id="browsers_ajax"></div>-->
<script>var useOfficialGovtHeader = true;</script>
<section class="usa-banner">
  <div class="usa-accordion">
    <header class="usa-banner-header">
blastn ncbi qblast blast

0 answers

No answers yet.

Log in to answer this question.