Hello -
I am working on a project with RNA-seq data that has paired end reads. The sequencing was done using PrepX RNA-seq libraries (I'm not sure if this is important or not) and rRNA was removed prior to sequencing because we are also interested in long noncoding RNAs.
We are running cutadapt to trim the adaptors and then STAR. When I run STAR on my untrimmed (raw) reads it runs fine.
However, the problem occurs when I run STAR on the trimmed reads. When I do this STAR ends due FATAL ERROR in reads input: quality string length is not equal to sequence length.
Why does STAR work on the untrimmed reads but not the trimmed reads? It seems to me like there is an issue with cutadapt but I haven't see anything online to point me in the right direction.
Here is the command I ran for cutadapt:
cutadapt -q 15,10 -a AAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -A GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT -o outputfiles/S_${n}_R1.fastq.gz -p outputfiles2/S_${n}_R2.fastq.gz $inputF $inputR
here is the command I ran for STAR:
STAR --runMode alignReads --runThreadN 12 --genomeDir star/index
--outSAMtype BAM Unsorted SortedByCoordinate --readFilesCommand zcat --readFilesIn outputfiles2/S_0_R1.fastq.gz outputfiles2/S_0_R2.fastq.gz --outFileNamePrefix mapped_star/test/S0_aligned
0 answers
No answers yet.
Log in to answer this question.
Probably the cutadapt run experienced some problem on the way producing corrupted fastq. cutadapt and star are extensively used and tested, and work if input is fine and jobs exit without error.