This is a test version of Biostars. For the public version, visit https://www.biostars.org.
By what criteria I can filter the somatic variants after annotation?

Hi all

Here is the head .vcf file after annotation by ANNOVAR. (for tumor sample file)

Chr Start   End Ref Alt Func.refGene    Gene.refGene    GeneDetail.refGene  ExonicFunc.refGene  AAChange.refGene    Func_ensGene    Gene_ensGene    GeneDetail_ensGene  ExonicFunc_ensGene  AAChange_ensGene    avsnp150    CLNALLELEID CLNDN   CLNDISDB    CLNREVSTAT  CLNSIG  Coding_CosmicV92    DamagePredCount SIFT_pred   SIFT4G_pred Polyphen2_HDIV_pred Polyphen2_HVAR_pred LRT_pred    MutationTaster_pred MutationAssessor_pred   FATHMM_pred PROVEAN_pred    VEST4_score MetaSVM_pred    MetaLR_pred M.CAP_pred  REVEL_score MutPred_score   MVP_score   MPC_score   PrimateAI_pred  DEOGEN2_pred    BayesDel_addAF_pred BayesDel_noAF_pred  ClinPred_pred   LIST.S2_pred    CADD_raw    CADD_phred  DANN_score  fathmm.MKL_coding_pred  fathmm.XF_coding_pred   Eigen.raw_coding    Eigen.phred_coding  Eigen.PC.raw_coding Eigen.PC.phred_coding   GenoCanyon_score    integrated_fitCons_score    GM12878_fitCons_score   H1.hESC_fitCons_score   HUVEC_fitCons_score LINSIGHT    GERP.._NR   GERP.._RS   phyloP100way_vertebrate phyloP30way_mammalian   phyloP17way_primate phastCons100way_vertebrate  phastCons30way_mammalian    phastCons17way_primate  bStatistic  Interpro_domain GTEx_V8_gene    GTEx_V8_tissue  AF  AF_popmax   AF_male AF_female   AF_raw  AF_afr  AF_sas  AF_amr  AF_eas  AF_nfe  AF_fin  AF_asj  AF_oth  non_topmed_AF_popmax    non_neuro_AF_popmax non_cancer_AF_popmax    controls_AF_popmax  AF.1    AF_popmax.1 AF_male.1   AF_female.1 AF_raw.1    AF_afr.1    AF_sas.1    AF_amr.1    AF_eas.1    AF_nfe.1    AF_fin.1    AF_asj.1    AF_oth.1    non_topmed_AF_popmax.1  non_neuro_AF_popmax.1   non_cancer_AF_popmax.1  controls_AF_popmax.1    ICGC_Id ICGC_Occurrence Noncoding_CosmicV92 Mutation_type_DoCM_3.2  Info.CIViC  InterVar_automated  PVS1    PS1 PS2 PS3 PS4 PM1 PM2 PM3 PM4 PM5 PM6 PP1 PP2 PP3 PP4 PP5 BA1 BS1 BS2 BS3 BS4 BP1 BP2 BP3 BP4 BP5 BP6 BP7 Kaviar_AF   Kaviar_AC   Kaviar_AN   Otherinfo1  Otherinfo2  Otherinfo3  Otherinfo4  Otherinfo5  Otherinfo6  Otherinfo7  Otherinfo8  Otherinfo9  Otherinfo10 Otherinfo11 Otherinfo12 Otherinfo13 Otherinfo14
chr12   53894576    53894576    -   G   upstream    TARBP2  dist=129    .   .   ncRNA_exonic    ENSG00000270175 .   .   .   rs398019638 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0858  0.0965  0.0867  0.0846  0.0860  0.0814  .   0.0532  0.0432  0.0965  0.0715  0.1469  0.0858  0.0948  0.0965  .   0.0922  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.00146 38  26028   0.25    .   19  chr12   53894576    rs398019638_53894576    C   CG  .   GTQ;QUAL;badReads   BRF=0.43;DB;FR=0.2500;HP=8;HapScore=2;MGOF=15;MMLQ=12;MQ=60.0;NF=5;NR=2;PP=139;QD=22.2857142857;SC=GAGGCGGGGTCGGGGGGGGCT;SOMATIC;SbPval=0.78;Source=Platypus;TC=28;TCF=15;TCR=13;TR=7;WE=53894584;WS=53894566   GT:GL:GOF:GQ:NR:NV  0/0:0.0,-4.0,-27.8:15:40:9:0    0/1:-16.58,0.0,-16.28:5:99:19:7
chr14   95555538    95555538    T   -   UTR3    DICER1  NM_001291628.1:c.*1297delA;NM_001271282.3:c.*1297delA;NM_177438.2:c.*1297delA;NM_001195573.1:c.*1413delA;NM_030621.4:c.*1297delA    .   .   UTR3    ENSG00000100697 ENST00000526495:c.*1297delA;ENST00000343455:c.*1297delA;ENST00000393063:c.*1297delA .   .   rs899307216 .   .   .   .   .   ID=COSV58616739;OCCURENCE=1(upper_aerodigestive_tract)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0033  0.0098  0.0034  0.0032  0.0067  0.0049  .   0.0098  0.0046  0.0011  0.0083  0.0043  0.0072  0.0104  0.0055  .   0.0109  MU67398057  ORCA-IN|1|178|0.00561798    ID=COSV58616739;OCCURENCE=1(upper_aerodigestive_tract)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0001537   4   26028   0.25    .   27  chr14   95555537    .   GT  G   .   VAFC    BRF=0.27;FR=0.2501;HP=13;HapScore=3;MGOF=8;MMLQ=18;MQ=58.97;NF=7;NR=13;PP=214;QD=10.95;SC=GCCTAAAGAAGTTTTTTTTTT;SOMATIC;SbPval=0.52;Source=Platypus;TC=61;TCF=26;TCR=35;TR=20;WE=95555547;WS=95555527   GT:GL:GOF:GQ:NR:NV  0/0:0.0,-4.81,-47.2:4:48:34:2   1/0:-22.7,0.0,-3.1:8:31:27:18
chr14   95557516    95557516    C   T   intron  DICER1  NM_001291628.1:exon25:c.5527+24G>A;NM_001271282.3:exon25:c.5527+24G>A;NM_177438.2:exon25:c.5527+24G>A;NM_030621.4:exon27:c.5527+24G>A   .   .   intron  ENSG00000100697 ENST00000526495:exon27:c.5527+24G>A;ENST00000343455:exon25:c.5527+24G>A;ENST00000393063:exon26:c.5527+24G>A;ENST00000527414:exon25:c.5527+24G>A;ENST00000556045:exon8:c.2221+24G>A  .   .   rs759709100 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   1.196e-05   2.645e-05   1.473e-05   8.689e-06   1.193e-05   0   0   0   0   2.645e-05   0   0   0   2.694e-05   1.119e-05   2.929e-05   2.339e-05   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   MU79342560  LIRI-JP|1|258|0.00387597    .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   1.94e-05    3   154602  0.25    .   35  chr14   95557516    .   C   T   .   PASS    AF=0.00,0.37;MQ=60;SNP=.;SOMATIC    GT:DP:DP4   0/0:36:22,14,0,0    0/1:35:10,12,8,5
chr14   95574595    95574595    T   -   intronic    DICER1  .   .   .   intronic    ENSG00000100697 .   .   .   rs878976709 .   .   .   .   .   ID=COSV58626763;OCCURENCE=1(biliary_tract)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0043  0.0063  0.0043  0.0043  0.0077  0.0044  .   0.0063  0   0.0035  0.0133  0.0123  0.0025  0.0067  0.0051  .   0.0052  MU111921835 BTCA-SG|2|71|0.028169   ID=COSV58626763;OCCURENCE=1(biliary_tract)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0005379   14  26028   0.5 .   35  chr14   95574594    .   GT  G   .   VAFC    BRF=0.27;FR=0.5000;HP=13;HapScore=4;MGOF=9;MMLQ=18;MQ=59.61;NF=16;NR=14;PP=417;QD=14.0666666667;SC=CTTACTACTAGTTTTTTTTTT;SOMATIC;SbPval=0.39;Source=Platypus;TC=58;TCF=28;TCR=30;TR=30;WE=95574604;WS=95574584  GT:GL:GOF:GQ:NR:NV  0/0:0.0,-5.23,-37.5:2:52:23:3   1/1:-43.2,-5.17,0.0:9:52:35:27
chr14   95593160    95593163    AAAA    -   intronic    DICER1  .   .   .   intronic    ENSG00000100697 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.25    .   24  chr14   95593159    .   CAAAA   C   .   ALTC;QD;VAFC;badReads   BRF=0.4;FR=0.2500;HP=14;HapScore=4;MGOF=15;MMLQ=12;MQ=57.48;NF=12;NR=19;PP=253;QD=8.29032258065;SC=TTTCAAAAAGCAAAAAAAAAA;SOMATIC;SbPval=0.77;Source=Platypus;TC=53;TCF=26;TCR=27;TR=31;WE=95593171;WS=95593147  GT:GL:GOF:GQ:NR:NV  0/0:0.0,-7.22,-73.1:11:72:29:13 0/1:-30.79,0.0,-18.39:15:99:24:18
chr16   24761873    24761873    A   G   intronic    TNRC6A  .   .   .   intronic    ENSG00000090905 .   .   .   .   .   .   .   .   .   ID=COSV59371456;OCCURENCE=1(liver)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   MU3773188   LIRI-JP|1|258|0.00387597    .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.25    .   40  chr16   24761873    .   A   G   .   PASS    AF=0.00,0.50;MQ=60;SNP=.;SOMATIC    GT:DP:DP4   0/0:33:20,13,0,0    0/1:40:12,8,9,11
chr16   24788148    24788148    T   -   intronic    TNRC6A  .   .   .   intronic    ENSG00000090905 .   .   .   .   .   .   .   .   .   ID=COSV100170668;OCCURENCE=1(stomach)   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   MU9052063   LIRI-JP|1|258|0.00387597,PACA-AU|1|391|0.00255754,GACA-JP|1|585|0.0017094   ID=COSV100170668;OCCURENCE=1(stomach)   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.25    .   49  chr16   24788147    .   GT  G   .   PASS    BRF=0.13;FR=0.2500;HP=8;HapScore=2;MGOF=8;MMLQ=31;MQ=60.0;NF=11;NR=9;PP=463;QD=24.2;SC=GAAAGCTTCTGTTTTTTTAGG;SOMATIC;SbPval=0.25;Source=Platypus;TC=83;TCF=35;TCR=48;TR=20;WE=24788156;WS=24788137  GT:GL:GOF:GQ:NR:NV  0/0:0.0,-8.73,-101.8:4:87:34:0  1/0:-49.35,0.0,-79.85:8:99:49:20
chr16   24802029    24802029    A   -   exonic  TNRC6A  .   frameshift deletion TNRC6A:NM_001330520.3:exon6:c.2066delA:p.S690Vfs*19,TNRC6A:NM_001351850.2:exon6:c.2093delA:p.S699Vfs*19,TNRC6A:NM_014494.4:exon6:c.2066delA:p.S690Vfs*19    exonic  ENSG00000090905 .   frameshift deletion ENSG00000090905:ENST00000315183:exon6:c.2066delA:p.S690Vfs*19,ENSG00000090905:ENST00000395799:exon6:c.2066delA:p.S690Vfs*19 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   MU3773189   LIRI-JP|1|258|0.00387597    .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.25    .   45  chr16   24802028    .   GA  G   .   PASS    BRF=0.17;FR=0.2500;HP=3;HapScore=2;MGOF=8;MMLQ=25;MQ=59.58;NF=4;NR=14;PP=586;QD=34.4444444444;SC=AGGAACTGGGGAAAGTCAGAG;SOMATIC;SbPval=0.78;Source=Platypus;TC=69;TCF=17;TCR=52;TR=18;WE=24802037;WS=24802018    GT:GL:GOF:GQ:NR:NV  0/0:0.0,-6.92,-103.8:3:69:24:0  0/1:-62.96,0.0,-109.46:8:99:45:18
chr16   24807066    24807066    T   G   intronic    TNRC6A  .   .   .   intronic    ENSG00000090905 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0   .   45  chr16   24807066    .   T   G   .   FRQ;RE;SBAF;TAC AF=0.00,0.04;MQ=60;SNP=.;SOMATIC    GT:DP:DP4   0/0:36:20,16,0,0    0/0:45:26,17,0,2
chr16   24833635    24833635    G   T   intronic    TNRC6A  .   .   .   intronic    ENSG00000090905 .   .   .   .   .   .   .   .   .   ID=COSV59371481;OCCURENCE=1(liver)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   MU3773192   LIRI-JP|1|258|0.00387597    ID=COSV59371481;OCCURENCE=1(liver)  .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.25    .   38  chr16   24833635    .   G   T   .   PASS    AF=0.00,0.55;MQ=60;SNP=.;SOMATIC    GT:DP:DP4   0/0:21:10,11,0,0    0/1:38:7,10,12,9
chr16   24835952    24835952    A   -   UTR3    TNRC6A  NM_001351850.2:c.*824delA;NM_001330520.3:c.*824delA;NM_014494.4:c.*824delA  .   .   UTR3    ENSG00000090905 ENST00000315183:c.*824delA;ENST00000395799:c.*824delA;ENST00000491718:c.*6238delA;ENST00000450465:c.*824delA;ENST00000432286:c.*242delA .   .   rs35671423  .   .   .   .   .   ID=COSV59362162;OCCURENCE=2(central_nervous_system) .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.2798  0.3408  0.2769  0.2833  0.2550  0.1971  .   0.1744  0.0007  0.3408  0.3922  0.2370  0.2902  0.3435  0.3406  .   0.3678  MU75989519  COCA-CN|1|321|0.00311526    ID=COSV59362162;OCCURENCE=2(central_nervous_system) .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0363455   946 26028   0.25    .   42  chr16   24835951    rs35671423_24835951 CA  C   .   VAFC    BRF=0.32;DB;FR=0.2500;HP=11;HapScore=2;MGOF=15;MMLQ=25;MQ=59.49;NF=5;NR=9;PP=174;QD=13.2857142857;SC=ATGTAAAAGACAAAAAAAAAA;SOMATIC;SbPval=0.26;Source=Platypus;TC=62;TCF=36;TCR=26;TR=14;WE=24835960;WS=24835941    GT:GL:GOF:GQ:NR:NV  0/0:0.0,-6.32,-48.2:3:63:20:1   0/1:-19.59,0.0,-41.09:15:99:42:13
chr17   62495643    62495643    A   -   UTR3    DDX5    NM_001320597.2:c.*398delT;NM_001320596.2:c.*398delT;NM_001320595.2:c.*398delT;NM_004396.5:c.*398delT    .   .   downstream  ENSG00000108654 dist=91 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   4.851e-05   0.0007  0   0.0001  0.0003  0   .   0   0.0007  0   0   0   0   0.0007  0.0007  .   .   MU111999412 COCA-CN|1|321|0.00311526,BTCA-SG|1|71|0.0140845 .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   .   0.0001537   4   26028   0.25    .   46  chr17   62495642    .   GA  G   .   VAFC    BRF=0.39;FR=0.2500;HP=10;HapScore=3;MGOF=13;MMLQ=26;MQ=58.56;NF=14;NR=12;PP=268;QD=10.7692307692;SC=TGTTTTCATGGAAAAAAAAAA;SOMATIC;SbPval=0.51;Source=Platypus;TC=86;TCF=44;TCR=42;TR=26;WE=62495651;WS=62495632 GT:GL:GOF:GQ:NR:NV  0/0:0.0,-11.64,-86.2:3:99:40:4  0/1:-28.95,0.0,-36.15:13:99:46:22

Now I don't know which of the variants are correct and acceptable. I would appreciate it if you could give me some hints.

vcf annovar variant filter

2 answers

To find correct variants, GATK recommends filtering on QD > 2. (QD = QUAL/DP) I believe you would have to do this before annotation. (See the link below for GATK's recommendations.) After annotation, it depends on what you're looking for. The CADD_phred score is supposed to give you the most deleterious variants, although this is not always the case in practice. To find the variants in the top 10% for CADD_phred, you would filter on CADD_phred > 10. (See the second link below.)

Hard-filtering Variants

CADD Scores

Dear Zahra,

it's not easy to help you as the file that you attached has some format issues. Anyway, if you mean which variant has passed the quality control you have to use the "FILTER" field that usually contain values as "PASS". That means that the variant has passed the quality check.

Best regards,

AY

Log in to answer this question.