Hi,

I'm super new to WGS and bioinformatics, but I'm a classic software data scientist, so I know enough to be annoying.

I'm using Platypus too call variants on 100X WGS via Nebula Genomics. I found an odd series of calls and am not sure if this is noise, or a mutation.

Is this a thing to investigate, or just junk?

Chr: chrX
Position: 67631951-67631955
ID: .
Reference: AGGGG*
Alternate: TGGGT
Qual: 160
Type: MNP
Is Filtered Out: Yes
- alleleBias

Alleles:
Alternate Alleles: TGGGT
Allele Frequency: -1.0

Variant Attributes
PP: 160
MMLQ: 35
TCR: 8
Mapping Quality: 44.97
NR: 0
HP: 4
HapScore: 1
FR: 0.5000
SbPval: 1.0
Source: #
WE: 67631979
TC: 20
SC: TAGGCTGCTCAGGGGTCAGGG
QD: 106.733937431
MGOF: 15
TCF: 12
BRF: 0.11
NF: 2
WS: 67631941
TR: 2