This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Do you need to define adapter sequences for trimming and QC tools?

Hi,

I have around 70 samples which have undergone WES.

I have a list of the adapters used for each sample; however, it seems that the sequencing company used lots of different adapters for each sample (I.e they all used different adapters). Originally, I was going to use the adapter sequences as an input for fastp and then run it in parallel. However, because the adapter sequences are all different, I don't think I can do this.

Is there a way to just run fastp on default to find adapters or is it good practice to provide each individual adapter sequence?

enter image description here

Thanks! Amy

adapters fastp illumina trimming
• 3,197 views • link
written by hello_bioinf • hello_bioinf

However, because the adapter sequences are all different, I don't think I can do this.

You absolutely can. In Illumina sequencing there is a core sequence at beginning of adapters as @Istvan showed below. So any adapter sequence is always going to be present on 3'-end of reads (unless you have adapterdimers). Scanning/trimming programs identify this sequence and then trim remaining read 3' of that adapter (including it).

• 0 views • link
written by GenoMax GenoMax

Thanks GenoMax and @Istvan! So, would it be okay to use a scanning/trimming program without giving it these adapter sequences because they will already look for this core sequence?

Or would you give fastp the adapters for each sample separately?

Thank you for your patience!! Amy

• 0 views • link
written by hello_bioinf • hello_bioinf

First I would establish that the adapter does indeed exist.

Many adapters are automatically recognized by fastp and reported in the HTML file that gets generated by default. FastQC also recognizes a number of common adapters and shows them in the report.

Run these tools on a few samples and see what these say.

• 0 views • link
written by Istvan Albert Istvan Albert

1 answer

If the samples are already split then usually the adapters are also trimmed out. That is the standard operating protocol.

Note how these indices are far into the adapter and there would also be fairly long other adapter sequences present. For example:

CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG

So even if the adapter were present all you would need is to trim by the start of the sequence CAAGCAGAAGACGGC as that would match all other adapters as well.

• 0 views • link
written by Istvan Albert Istvan Albert

If the samples are already split then usually the adapters are also trimmed out. That is the standard operating protocol.

Not necessarily. Sequencing facilities may simply demultiplex the data and not do any trimming.

• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this