This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Mutations in contiguous sites within a sample

Hi everyone,
I have followed the gatk somatic short variants discovery workflow but I found that there are some variants that are adjacent to each other as below. I am wondering if there is a reason why mutect does not combine them? Should I be checking all the mutations that are very close by in the bam file one by one?

e.g. M35 (9683756 CC>TT isn't it the same mutation as 9683757 C>T?), M48 (49041108 C>A 49041109 C>A so I should change it into CC>AA?) .

and how would you deal with e.g. M46 (39727366 C>CAA and 39727367 TCC>T there is an insertion and deletion right next to each other? Or is it an indication that I might have done something wrong? These mutaitons represents less than 1% of the total number of mutations but I just want to make sure I am doing the right thing.

Thank you for your help!

id  chr pos ref alt
M35 1   9683756 CC  TT
M35 1   9683757 C   T
M35 10  43114056    G   GTT
M35 10  43114057    ACAC    A
M45 14  22978099    G   A
M45 14  22978100    A   AGGTGAGGAAGGAAGGAG
M45 20  32434632    C   T
M45 20  32434633    AT  A
M45 4   186589050   G   T
M45 4   186589051   AG  A
M46 14  78835175    G   A
M46 14  78835176    G   A
M46 17  7674220 C   G
M46 17  7674221 G   C
M46 17  39727366    C   CAA
M46 17  39727367    TCC T
M46 2   38986124    T   TG
M46 2   38986125    T   TAGGCTCTCTAGCTGGTAGAATAATCTGAGCTACAA
M47 4   186618715   T   C
M47 4   186618716   C   T
M47 9   132944745   GG  AA
M47 9   132944746   G   A
M48 12  49041108    C   A
M48 12  49041109    C   A
M51 11  24201469    A   AGC
M51 11  24201470    A   ATTCTAGC
M53 4   186706729   C   CCA
M53 4   186706730   ACGG    A
M54 17  12127139    C   T
M54 17  12127140    GT  G
snp vcf
• 1,340 views • link
written by whb • whb

do you have the associated allele frequency for each site ?

• 0 views • link
written by Nicolas Rosewick Nicolas Rosewick

Hi Nicolas yes I have added the column which contains the count and af (bold). Please let me know what you think. Thanks again.

sampleid    chr pos ref alt GT:AD:**AF**:DP:F1R2:F2R1:PGT:PID:PS:SB
M35 1   9683756 CC  TT  0|1:1585,67:**0.042**:1652:761,31:798,35:0|1:9683756_CC_TT:9683756:557,1028,19,48
M35 1   9683757 C   T   1|0:1553,90:**0.031**:1643:742,44:791,46:1|0:9683756_CC_TT:9683756:541,1012,30,60
M35 10  43114056    G   GTT 0|1:2377,87:**0.038**:2464:1178,42:1135,43:0|1:43114056_G_GTT:43114056:1227,1150,53,34
M35 10  43114057    ACAC    A   0|1:2441,88:**0.038**:2529:1196,44:1134,43:0|1:43114056_G_GTT:43114056:1250,1191,54,34
M45 14  22978099    G   A   0/1:324,5:**0.022**:329:147,3:157,2:217,107,4,1
M45 14  22978100    A   AGGTGAGGAAGGAAGGAG  0/1:204,86:**0.297:**290:104,26:92,43:135,69,55,31
M45 20  32434632    C   T   0|1:1726,46:**0.027**:1772:813,25:879,19:0|1:32434632_C_T:32434632:806,920,26,20
M45 20  32434633    AT  A   0|1:1726,46:**0.027**:1772:779,25:846,19:0|1:32434632_C_T:32434632:806,920,26,20
M45 4   186589050   G   T   0|1:2600,45:**0.018**:2645:1355,22:1233,20:0|1:186589050_G_T:186589050:1237,1363,22,23
M45 4   186589051   AG  A   0|1:2669,41:**0.016**:2710:1351,21:1234,20:0|1:186589050_G_T:186589050:1271,1398,21,20
M46 14  78835175    G   A   0/1:746,23:**0.03**:769:368,11:367,12:402,344,14,9
M46 14  78835176    G   A   0/1:737,21:**0.029**:758:364,13:366,8:396,341,10,11
M46 17  7674220 C   G   0|1:1670,102:**0.059**:1772:775,46:881,55:0|1:7674220_C_G:7674220:812,858,44,58
M46 17  7674221 G   C   1|0:1729,60:**0.031**:1789:812,28:906,31:1|0:7674220_C_G:7674220:847,882,28,32
M46 17  39727366    C   CAA 0|1:1098,15:**0.015**:1113:527,8:531,5:0|1:39727366_C_CAA:39727366:678,420,8,7
M46 17  39727367    TCC T   0|1:1135,15:**0.015**:1150:526,10:533,5:0|1:39727366_C_CAA:39727366:681,454,8,7
M46 2   38986124    T   TG  0|1:2605,6:**0.001323**:2611:1205,3:1274,3:0|1:38986124_T_TG:38986124:983,1622,3,3
M46 2   38986125    T   TAGGCTCTCTAGCTGGTAGAATAATCTGAGCTACAA    0|1:2605,7:**0.001325**:2612:1162,3:1284,3:0|1:38986124_T_TG:38986124:983,1622,4,3
M47 4   186618715   T   C   0/1:2472,156:**0.061**:2628:1202,67:1215,87:1088,1384,83,73
M47 4   186618716   C   T   0/1:2571,53:**0.02**:2624:1222,25:1258,23:1150,1421,24,29
M47 9   132944745   GG  AA  0|1:976,9:**0.011**:985:443,4:511,4:0|1:132944745_GG_AA:132944745:442,534,3,6
M47 9   132944746   G   A   1|0:937,41:**0.033**:978:428,22:497,18:1|0:132944745_GG_AA:132944745:426,511,19,22
M48 12  49041108    C   A   0|1:1656,59:**0.035**:1715:806,30:840,29:0|1:49041108_C_A:49041108:727,929,24,35
M48 12  49041109    C   A   1|0:1674,28:**0.015**:1702:813,16:855,11:1|0:49041108_C_A:49041108:727,947,12,16
M51 11  24201469    A   AGC 0|1:18,3:**0.179**:21:8,3:10,0:0|1:24201469_A_AGC:24201469:2,16,0,3
M51 11  24201470    A   ATTCTAGC    0|1:18,3:**0.179**:21:8,3:9,0:0|1:24201469_A_AGC:24201469:2,16,0,3
M53 4   186706729   C   CCA 0|1:1941,107:**0.053**:2048:948,53:940,53:0|1:186706729_C_CCA:186706729:1143,798,70,37
M53 4   186706730   ACGG    A   0|1:2006,107:**0.052**:2113:953,52:938,52:0|1:186706729_C_CCA:186706729:1157,849,70,37
M54 17  12127139    C   T   0|1:1061,11:0.012:1072:486,6:524,5:0|1:12127139_C_T:12127139:567,494,8,3
M54 17  12127140    GT  G   0|1:1061,11:0.012:1072:501,6:515,5:0|1:12127139_C_T:12127139:567,494,8,3
• 0 views • link
written by whb • whb

0 answers

No answers yet.

Log in to answer this question.

More posts like this