I think, one still needs to process both files, unfortunately.
As far as I know, umi_tools dedup needs the UMI embedded in the header of both reads of a pair, even if the sequence will just be duplicated.
Hi guys,
For the first time, we used UMIs for the RNAseq. So I don't know exactly how to deal with that. I would really appreciate it if you could help me.
We used SMARTer Stranded Total RNA-Seq Kit v3 for the library preparation. And the manual show that
'The first 8 nt of the second sequencing read (Read 2) are UMIs (dark purple) followed by 3 nucleotides of UMI-linker (shown as NNN) and 3 nucleotides derived from the Pico v3 SMART UMI Adapter (shown as XXX).'
And I would like to try as below (8nt UMI):
umi_tools extract -I pair.1.fastq.gz --bc-pattern=NNNNNNNN \
--read2-in=pair.2.fastq.gz --stdout=processed.1.fastq.gz \
--read2-out=processed.2.fastq.gz
Is it correct? or should I use the linker and adapter? (14nt)
umi_tools extract -I pair.1.fastq.gz --bc-pattern=NNNNNNNNNNNNNN \
--read2-in=pair.2.fastq.gz --stdout=processed.1.fastq.gz \
--read2-out=processed.2.fastq.gz
Please help me to figure out. Thanks a lot.
Kim
P.S. And our fastq file of second reads as below:
@NB551656:25:H3N2YBGXK:1:11101:17925:1178 2:N:0:4
GTCATGAACGAGTCAGGCCAAGGGCATCAATTGCCCGTCACCGGAAGGCGCATTCTACGTCTACCCGTCCTGCGCC
+
AAAAAEEE////A/EEEEEEEEEEEEEEEEEEEE<EEEEAEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEAEAE
@NB551656:25:H3N2YBGXK:1:11101:6227:1179 2:N:0:4
GTGGGTTCCTTTGGTCTTGTTGCGTACCTGGAGAACGGAAGAGCGTCGTGTAGGGAAATAGTGTAAGTCCAAGTGT
+
AAAAAEEA/A///EE//EE/EE/AEEE<E//E/E/AE/EE//E6/EE/E/EE/E<E<E/E/E/EAEE</6AE///A
@NB551656:25:H3N2YBGXK:1:11101:14235:1180 2:N:0:4
ACTAAGCGGTGGGGTGATCGCCGAGAGCAAAGGTAAGGCTAAGAAAGGAAGACCAGGTTGGAGCCTTGAGAAAAAT
Using your example you would need to only process read 2 since based on Takarabio directions that is the read that contains UMI.
$ more test.fq
@NB551656:25:H3N2YBGXK:1:11101:17925:1178 2:N:0:4
GTCATGAACGAGTCAGGCCAAGGGCATCAATTGCCCGTCACCGGAAGGCGCATTCTACGTCTACCCGTCCTGCGCC
+
AAAAAEEE////A/EEEEEEEEEEEEEEEEEEEE<EEEEAEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEAEAE
@NB551656:25:H3N2YBGXK:1:11101:6227:1179 2:N:0:4
GTGGGTTCCTTTGGTCTTGTTGCGTACCTGGAGAACGGAAGAGCGTCGTGTAGGGAAATAGTGTAAGTCCAAGTGT
+
AAAAAEEA/A///EE//EE/EE/AEEE<E//E/E/AE/EE//E6/EE/E/EE/E<E<E/E/E/EAEE</6AE///A
$ umi_tools extract --stdin=test.fq --bc-pattern=NNNNNNNN --log=processed.log --stdout=processed.fastq
$ more processed.fastq
@NB551656:25:H3N2YBGXK:1:11101:17925:1178_GTCATGAA 2:N:0:4
CGAGTCAGGCCAAGGGCATCAATTGCCCGTCACCGGAAGGCGCATTCTACGTCTACCCGTCCTGCGCC
+
////A/EEEEEEEEEEEEEEEEEEEE<EEEEAEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEAEAE
@NB551656:25:H3N2YBGXK:1:11101:6227:1179_GTGGGTTC 2:N:0:4
CTTTGGTCTTGTTGCGTACCTGGAGAACGGAAGAGCGTCGTGTAGGGAAATAGTGTAAGTCCAAGTGT
+
/A///EE//EE/EE/AEEE<E//E/E/AE/EE//E6/EE/E/EE/E<E<E/E/E/EAEE</6AE///A
After this you can hard trim 6 bp from front of processed reads to remove the linker+UMI adapter using reformat.sh from BBMap suite.
$ reformat.sh -Xmx2g in=processed.fastq out=out.fq forcetrimleft=6
$ more out.fq
@NB551656:25:H3N2YBGXK:1:11101:17925:1178_GTCATGAA 2:N:0:4
AGGCCAAGGGCATCAATTGCCCGTCACCGGAAGGCGCATTCTACGTCTACCCGTCCTGCGCC
+
EEEEEEEEEEEEEEEEEEEE<EEEEAEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEAEAE
@NB551656:25:H3N2YBGXK:1:11101:6227:1179_GTGGGTTC 2:N:0:4
TCTTGTTGCGTACCTGGAGAACGGAAGAGCGTCGTGTAGGGAAATAGTGTAAGTCCAAGTGT
+
E//EE/EE/AEEE<E//E/E/AE/EE//E6/EE/E/EE/E<E<E/E/E/EAEE</6AE///A
I think, one still needs to process both files, unfortunately.
As far as I know, umi_tools dedup needs the UMI embedded in the header of both reads of a pair, even if the sequence will just be duplicated.
Thanks for making a note of that. I guess only read 2 (sense strand) could be used since read 1 is simply anti-sense sequence.
Thanks a lot for your reply. I solved the problem. I can use --extract-method=regex and --bc-pattern='^(?P<umi_1>.{8})(?P<discard_1>.{6}).*'
I am not familiar with that particular kit, but you are almost there. However, the UMI is in your second read, so using --bc-pattern would mean that the UMI is being looked for in the wrong read!
As the UMI-tools manual describes, you can use the letters N C and X to denote the composition of the barcode in string mode. Bases with Ns and Cs will be extracted and added to the read name. The corresponding sequence qualities will be removed from the read. So using --extract-method=string and --bc-pattern2=NNNNNNNN should work.
Even more clever might be the --bc-pattern2=NNNNNNNNCCCCCC, which would treat the UMI-Linker and 3 base adapter sequence as cell barcode and move it to the header, too. Hence, it trims the linker away such that it doesn't interfere with the mapping later, since denoting the bases with an X would mean that they are reattached to the read and thus not removed. Treating the linker as cell barcode would also help to corroborate if you are correctly trimming the UMI, because that sequence should always be the same. So by visually inspecting a few read headers later, you will know if everything worked out as expected.
If first base of read2 is not always the first UMI base, which might happen if there is still a part of the adapter sequence in the read, use the Regex mode instead. In that case the 3'-sequence of the i7 adapter as well as the linker sequence can be used to locate your UMI.
I couldn't find the sequence of the linker (but you should be able to see that in your reads easily), but the i7 adapter should be GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-[index i7]-ATCTCGTATGCCGTCTTCTGCTTG. Therefore, a possible Regex to locate your UMI could look like --bc-pattern2="(?P<discard_1>CGTCTTCTGCTTG){s<=1}(?P<umi_1>.{8})(?P<discard_2>REPLACE WITH SEQUENCE OF THE LINKER)".
You might need to adapt that depending on the amount of adapter still to be found. It might also be possible to only use the sequence of the linker as anchor and skip the discard_1 group entirely. Good luck with your project!
PS: I would appreciate if you could post the six bases here that constitute the NNNXXX part in the figure above as a future reference in case we start working with the same kit. Thanks!
Thanks a lot for your reply. I solve the problem using similar way. I should keep 8nt of UMIs and trim the following 6nt of linker and adapter according to manual. Thanks a lot @GenoMax So I used command as below:
umi_tools extract --extract-method=regex -I pair.2.fastq.gz --bc-pattern='^(?P<umi_1>.{8})(?P<discard_1>.{6}).*' --read2-in=pair.1.fastq.gz --stdout=./umi_extract/pair.2_umi_extract.fastq.gz --read2-out=./umi_extract/pair.1_umi_extract.fastq.gz
I was wondering, if Read 2 has barcode:UMI at 5' end and Read 1 has barcode:UMI at 3' end, is umi-tools extract able to identify that the barcode:UMI sequence should be removed from the 3' end of Read 1? Or do I have to use regex in --bc-pattern to specify that barcode:UI should be searched from the 3' end of Read 1.. Do you know?
You can also refer to Nextflow documentation here: https://nf-co.re/rnaseq/3.18.0/docs/usage/#unique-molecular-identifiers-umi
In all fairness, I have to admit that this documentation didn't exist when this question was posted and also the pipeline didn't support --bc-pattern2 before version 3.9. I added it afterwards and used exactly this particular kit as example because of this question ;-)
Log in to answer this question.
TakaraBio tells you what to do with these in their user manual (page 25):
They also appear to make some software available to do this here: https://www.takarabio.com/products/next-generation-sequencing/bioinformatics-tools/cogent-ngs-analysis-pipeline
Thanks a lot for your reply. I want to use UMIs (8nt) but maybe trim linker (3nt) and adapter (3nt). cogent software is not best option for us, because we bought another software. Is there any option for the keep 8nt but trim 6nt in umi_tools?