I have aligned pair-end RNA clip-seq data to human genome, where the output bam file contains some reads like:
AAAAAAAAAC:HWI-D00611:153:C6PBEANXX:5:1309:5483:77560 89 NC_000001.11 51781228 255 38M * 0 0 TTTCATGCGGGAAGGAAAGGATCAGTTGCCAAAAAGCC <<//BBF<BBFFFFBFFFBFFFFBFBBFF<FFFFFF<F NH:i:1 HI:i:1 AS:i:37 nM:i:0
I am wondering what the * means in the sequence? As most of the reads have = at that position, and when there is a = there are always two reads with the same head, but when there is a * there is only one read with that head.
(what I mean by head is this part: AAAAAAAAAC:HWI-D00611:153:C6PBEANXX:5:1309:5483:77560)
And I also want to know how to filter how reads with * by using samtools or other tools. Thanks a lot for helping me get out of there.
1 answer
I believe that the * indicates that the RNEXT (Reference sequence name of the primary alignment of the NEXT read in the template) is not available. Basically, it means that the other read in the pair is not mapped.
You can filter these alignments with:
0x8 8 MUNMAP next segment in the template unmapped
a simple and biologically relevant explanation would be a contaminant, take any organism that shares some similarity with your reference, a fragment that originates in a similar region but ends in a dissimilar region will have a broken pair
you could also have some fusions in the sequence, the fused sequences produce fragments that don't quite exists in the reference
at the same time you could also have other weird things happening, more on the measurement or sequencing error side, one of the pairs being deteriorated
Log in to answer this question.
-
STARsolo sorted bam contains 'non-whitelisted' barcodes
written by mk
-
why STAR --clip[3p,5p]Nbases show up in the bam?
written by mk
-
genomecov -d -pc -ibam showing no coverage for every position
written by Gabrielle •
-
Cigar String really high N
written by nicolas.ares •
-
Unknown Data type error when using infer_experiment.py (rseqc)
written by irem •
-
featureCounts fragment count
written by xosugarxspicexo •
-
Extracting reads from one barcode in a bam file
written by msrinivasan •
-
Apply conditions to forward/reverse strands on BAM file (RNA-Seq)
written by ek699 •
-
How to efficiently remove a list of reads according to their ID and mapped position from BAM file?
written by MarVi •
-
Filter bam files using a bed file: Why is the mate missing?
written by komal.rathi
