This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Validate and Trim 3'adapter(P-UCGUAUGCCGUCUUCUGCUUGUidT)

Hi,all

I use the linked SRA to do CLIP-seq analysis, but in this experiment, it used 3'adapter P-UCGUAUGCCGUCUUCUGCUUGUidT, I never met this adapter before and I don't know what's idT mean.

I have used fastqc to analysis the .fastq, where Adapter Content passed.

I also used EBI's Karken minion to analysis whether 3'adapter trimmed or not, but it output nothing:

$ minion search-adapter -i TAIR.HLP1.fastq.gz
[minion] reading reads
.................................................  1
.................................................  2
[minion] set workspace to size 9029
[minion] connected component analysis
[minion] building consensus sequences
have 50

Is that means the SRA .fastq have been trimmed 3'adapter?

I would appreciate that if you can give detailed explanation about this adapter and suggestion about how to trim it.

Many thanks!

——————————————————————————————————————————————————————

Latest updated

I accept stuart archer & GenoMax’s explanation about idT:

3’ idT: Inverted dT can be incorporated at the 3’-end of an oligo, leading to a 3’-3’ linkage which inhibits both degradation by 3’ exonucleases and extension by DNA polymerases.

5’idT: Placing Inverted Dideoxy-T at the 5’ end of a sequence will prevent unwanted 5’ ligations.

And I follow Isrvan’s tutorial put transposed 3’adapter TCGTATGCCGTCTTCTGCTTGTT into a .txt file and using fastqc -a to verify 3’adapter whether trim or not.This time still passed Adapter Content.

To revalidate this, I also use fastp to detect 3’adapter and it output no adapter detected.

Based on Karken minion,fastp and fastqc, I conclude my target SRA had been trimmed 3’adapter when submitted.

Thanks for all of your advice!

ngs

I have used fastqc to analysis the .fastq, where Adapter Content passed.

FastQC is only looking for standard adapters. Since yours is clearly different this analysis is not valid/applicable. Unless you actually have U bases in your data you may need to convert the sequence of your adapter from U's to T's for any trimming program to be able to find the sequence.

It is possible that the submitted data is already trimmed and there is no adapter present.

idT probably refers inverted dideoxyT modification - https://www.idtdna.com/site/Catalog/Modifications/Product/2835

idT indicates a 3' inverted dT is present. This means that chemically the 3' end of the adapter is more like a 5' end, inhibiting 3' extension and degradation of the adapter. See: https://sg.idtdna.com/site/catalog/modifications/product/1360

I've written a trimming visualisation tool to double-check if your trimming is doing what you think it's doing, and also check alignment files to see whether there are parts of your reads that are consistently soft-clipped, which may indicate a problem with the initial trimming. You may find it handy: https://github.com/MonashBioinformaticsPlatform/trimviz

1 answer

Turn your adapter into DNA, place the sequence as name[tab]sequence format into a file

ClipAdapter TCGTATG
PolyA   AAAAAA

I have added PolyA as well since the data seems to have that as well. Run fastqc with the -a adapter_file.txt parameter.

fastqc -a adapter_list.txt SRR517963.fq

You will see that now FastQC detects your adapter and produces the following image:

enter image description here

Log in to answer this question.