More posts like this
-
Create Seurat Object from matrix and two text files
written by Sky •
-
Analyzing single cell RNA seq with multiple samples and conditions
written by biotrekker •
-
How to use harmony integration with cross-species single-cell RNA sequencing datasets
written by samuel.storey •
-
How to create proteins of interest reference file for antibiotic resistant genes analysis?
written by ramin.k2013 •
-
SRA dataset to Seurat Object
written by AbsaR •
-
Sub clustering from Seurat Object
written by AbsaR •
-
The difference between merge and integration with Seurat objects
written by re_raz •
-
Seurat to Trajectory Analysis
written by AbsaR •
-
Seurat object create
written by KOUSTAV •
-
Add filename to fasta headers of multiple fasta files inside loop
written by bioinfo8
I assume you mean fastq files? See Cell Ranger, alevin-fry, or STARsolo documentation.
i am using starsolo on galaxy but i am getting the following error
EXITING because of FATAL ERROR in input read file: the total length of barcode sequence is 100 not equal to expected 28 Read ID=>SRR2431431.1 ; Sequence=ACTTAAAGGAATGTGGGCTTTATTGAGAGGATGGCATAGTAAAAGCTATTACAGGGAGGAGTGTTGAGACCAGATGTCATCTACTGTCTCTTGGGTCAGC SOLUTION: check the formatting of input read files. If UMI+CB length is not equal to the barcode read length, specify barcode read length with --soloBarcodeReadLength To avoid checking of barcode read length, specify --soloBarcodeReadLength 0
Does it mean that the RNA seq data is not 10x Chromium ? How to solve this error ?
for reference i am using E-GEOD-73121 dataset, and working with single cell rna seq of patients metastatic samples only