More posts like this
-
Create Seurat Object from matrix and two text files
written by Sky 1The data (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5596828) that is available to create a seurat object from Sci-sequencing data is the counts matrix (matrix.gz), cell annotation (txt.gz), and gene annotation …
-
Analyzing single cell RNA seq with multiple samples and conditions
written by biotrekker 11Hello all, I don't know if this is the appropriate place to ask to this question, but I am currently analyzing a single cell rna-seq …
-
How to use harmony integration with cross-species single-cell RNA sequencing datasets
written by samuel.storey 1I am relatively new to scRNAseq and after successfully analyzing my zebrafish dataset I wish to perform cross-species integration with publicly available datasets from GEO. …
-
How to create proteins of interest reference file for antibiotic resistant genes analysis?
written by ramin.k2013 0I want to explore the antibiotic resistant genes profile in my data using the [ShortBRED][1] pipeline. The pipeline requires two input files in the first …
-
SRA dataset to Seurat Object
written by AbsaR 0I have [this dataset][1] downloaded in fasta files using SRA toolkit in windows. How can I 1. merge all lane1 (fasta1) files into 1 file? …
-
Sub clustering from Seurat Object
written by AbsaR 0I want to create a sub-cluster and then plot it from a Seurat Object. For example from a group of different cell types I want …
-
The difference between merge and integration with Seurat objects
written by re_raz 9Hi everyone I have two questions: When can we use merge for Seurat objects? When can we use integration for Seurat objects? I have two …
-
Seurat to Trajectory Analysis
written by AbsaR 0I want to do trajectory analysis using https://dynverse.org/users/2-quick_start/ I dont know how to extract the inputs required for dynverse from seurat object
-
Seurat object create
written by KOUSTAV 0I need guidance to create Seurat object and how do I understand it properly created. I have to create any new project name for Seurate …
-
Add filename to fasta headers of multiple fasta files inside loop
written by bioinfo8 23Hi, I have 10 fasta files (each file with 20 gene sequences from each of the 10 samples). I would like to create 20 files, …
I assume you mean fastq files? See Cell Ranger, alevin-fry, or STARsolo documentation.
i am using starsolo on galaxy but i am getting the following error
EXITING because of FATAL ERROR in input read file: the total length of barcode sequence is 100 not equal to expected 28 Read ID=>SRR2431431.1 ; Sequence=ACTTAAAGGAATGTGGGCTTTATTGAGAGGATGGCATAGTAAAAGCTATTACAGGGAGGAGTGTTGAGACCAGATGTCATCTACTGTCTCTTGGGTCAGC SOLUTION: check the formatting of input read files. If UMI+CB length is not equal to the barcode read length, specify barcode read length with --soloBarcodeReadLength To avoid checking of barcode read length, specify --soloBarcodeReadLength 0
Does it mean that the RNA seq data is not 10x Chromium ? How to solve this error ?
for reference i am using E-GEOD-73121 dataset, and working with single cell rna seq of patients metastatic samples only