This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Convert Arlequin ("DNA" markers) to Genepop (PGDspider or otherwise)

Hi all,

I have Arlequin output files (*.arp) from fastSimcoal2 that I'm trying to convert to genpop files (to read into adegenet). The Arlequin files are using the "DNA" marker (50 bp long), and each includes ~2,500 samples.

When I try to use the program PGDspider to convert these files (either the GUI or the CLI, v2.1.1.5), things proceed smoothly until the 1,000th allele is reached, where the program generates an error:

INFO  07-03 11:18:10,630 (GenepopWriter.java:parseAlignedSampleData:596)  -Allele "TGGCATCAGCTTCTTCTAAGCAGGCCCGCTTTGTCTAGCGACAGATCTCG" converted to "999"
INFO  07-03 11:18:10,630 (GenepopWriter.java:parseAlignedSampleData:596)  -Allele "ATCTTGTGGTCATGGAGCACCCAGAGCCAAACTCCTAAAGAAGACCCCGC" converted to "1000"
ERROR 07-03 11:18:10,630 (GenepopWriter.java:parseAlignedSampleData:611)  -data "1000" in ind "2_375" (population: Sample 2) is too long!!!
INFO  07-03 11:18:10,631 (GenepopWriter.java:parseAlignedSampleData:618)  -In GENEPOP, alleles cannot be coded with more than 3 digits.

Is there a way around this? I've processed RADseq data with many 1,000s of alleles using adegenet before, so I know these types of files can be written to genpop--I just don't know how to specify this to PGDspider. There's a field in the .spid file that I might be able to use to fix this (see below), but I don't know what to populate that field with.

# Specify the locus/locus combination you want to write to the GENEPOP file:
GENEPOP_WRITER_LOCUS_COMBINATION_QUESTION=

Alternatively, if there are other suggestions for performing this conversion without using PGDspider, I'm all ears.

Thanks for your help!

pgdspider arlequin spid genepop adegenet
• 1,608 views • link
written by akoontz11 • akoontz11

1 answer

Answer: I've been able to do this using the R package strataG (no longer on CRAN, but can be obtained on GitHub). Specifically, the steps are:

  1. Read in .arp file, e.g. arpObject <- arlequinRead(file.arp)
  2. Convert arlequin object to gtype object (arp2gtypes function)
  3. Convert gtype object to genind object (gtypes2genind function)
• 0 views • link
written by akoontz11 • akoontz11

Log in to answer this question.

More posts like this