Hi,

I had downloaded some FASTQ files from SRA that I wanted to analyze. I checked in FASTQC (see https://ibb.co/vd0CxH3) and I could not see any adapter contamination, so I assumed the adaptors were removed. I proceeded with trimming (Trimmomatic) I then aligned the reads to the mm9 genome via STAR aligner (output as BAM sorted). To check the quality of my reads I used picard CollectAlignmentSummaryMetrics.

However, I did not get an output file and I saw that the screen printed some adaptor sequences (below). I googled those seqs and they seem to be Illumina True-seq adaptors.

**ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTT**G]

My questions are the following

1. Why was no output file generated by picard?
2. do I have a contamination with adaptor sequences (I guess so..)?
3. Why did Fastqc not detect the adaptors and if so, what can I do to make fastqc detect the adaptors.
4. are there any other strange things in the output below?

Thanks a lot!

Here is the complete picard output on screen.

21:45:50.682 INFO  NativeLibraryLoader - Loading libgkl_compression.dylib from jar:file:/Users/tsopoulidis/picard.jar!/com/intel/gkl/native/libgkl_compression.dylib
[Sun May 03 21:45:50 EDT 2020] CollectAlignmentSummaryMetrics INPUT=/Users/tsopoulidis/bam_files/Finnley_et_al_mm9_UCSC/SRR4423430.fastqAligned.sortedByCoord.out.bam OUTPUT=output_picard.txt REFERENCE_SEQUENCE=/Users/tsopoulidis/NCBIM37.genome.fa    MAX_INSERT_SIZE=100000 EXPECTED_PAIR_ORIENTATIONS=[FR] **ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTT**G] METRIC_ACCUMULATION_LEVEL=[ALL_READS] IS_BISULFITE_SEQUENCED=false COLLECT_ALIGNMENT_INFORMATION=true ASSUME_SORTED=true STOP_AFTER=0 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Sun May 03 21:45:50 EDT 2020] Executing as tsopoulidis@Hochedlinger-TsopMBP2018.local on Mac OS X 10.15.3 x86_64; Java HotSpot(TM) 64-Bit Server VM 14.0.1+7; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.22.4
INFO    2020-05-03 21:45:56 SinglePassSamProgram    Processed     1,000,000 records.  Elapsed time: 00:00:05s.  Time for last 1,000,000:    4s.  Last read position: MT:7,139
INFO    2020-05-03 21:45:58 SinglePassSamProgram    Processed     2,000,000 records.  Elapsed time: 00:00:07s.  Time for last 1,000,000:    1s.  Last read position: MT:14,174
INFO    2020-05-03 21:46:09 SinglePassSamProgram    Processed     3,000,000 records.  Elapsed time: 00:00:18s.  Time for last 1,000,000:   11s.  Last read position: 19:6,058,451
INFO    2020-05-03 21:46:10 SinglePassSamProgram    Processed     4,000,000 records.  Elapsed time: 00:00:19s.  Time for last 1,000,000:    1s.  Last read position: 19:16,238,686
INFO    2020-05-03 21:46:12 SinglePassSamProgram    Processed     5,000,000 records.  Elapsed time: 00:00:21s.  Time for last 1,000,000:    1s.  Last read position: 19:41,992,181
INFO    2020-05-03 21:46:13 SinglePassSamProgram    Processed     6,000,000 records.  Elapsed time: 00:00:22s.  Time for last 1,000,000:    1s.  Last read position: 18:11,880,447
INFO    2020-05-03 21:46:14 SinglePassSamProgram    Processed     7,000,000 records.  Elapsed time: 00:00:23s.  Time for last 1,000,000:    1s.  Last read position: 18:48,206,916
INFO    2020-05-03 21:46:16 SinglePassSamProgram    Processed     8,000,000 records.  Elapsed time: 00:00:25s.  Time for last 1,000,000:    1s.  Last read position: 18:82,508,559
INFO    2020-05-03 21:46:17 SinglePassSamProgram    Processed     9,000,000 records.  Elapsed time: 00:00:26s.  Time for last 1,000,000:    1s.  Last read position: 17:24,646,933
INFO    2020-05-03 21:46:18 SinglePassSamProgram    Processed    10,000,000 records.  Elapsed time: 00:00:27s.  Time for last 1,000,000:    1s.  Last read position: 17:33,961,267
INFO    2020-05-03 21:46:20 SinglePassSamProgram    Processed    11,000,000 records.  Elapsed time: 00:00:29s.  Time for last 1,000,000:    1s.  Last read position: 17:45,707,209
INFO    2020-05-03 21:46:21 SinglePassSamProgram    Processed    12,000,000 records.  Elapsed time: 00:00:30s.  Time for last 1,000,000:    1s.  Last read position: 17:81,017,680
INFO    2020-05-03 21:46:22 SinglePassSamProgram    Processed    13,000,000 records.  Elapsed time: 00:00:31s.  Time for last 1,000,000:    1s.  Last read position: 16:20,219,705
INFO    2020-05-03 21:46:24 SinglePassSamProgram    Processed    14,000,000 records.  Elapsed time: 00:00:33s.  Time for last 1,000,000:    1s.  Last read position: 16:55,969,722
INFO    2020-05-03 21:46:25 SinglePassSamProgram    Processed    15,000,000 records.  Elapsed time: 00:00:34s.  Time for last 1,000,000:    1s.  Last read position: 15:25,712,740
INFO    2020-05-03 21:46:26 SinglePassSamProgram    Processed    16,000,000 records.  Elapsed time: 00:00:35s.  Time for last 1,000,000:    1s.  Last read position: 15:75,726,842
INFO    2020-05-03 21:46:27 SinglePassSamProgram    Processed    17,000,000 records.  Elapsed time: 00:00:36s.  Time for last 1,000,000:    1s.  Last read position: 15:83,417,292
INFO    2020-05-03 21:46:29 SinglePassSamProgram    Processed    18,000,000 records.  Elapsed time: 00:00:38s.  Time for last 1,000,000:    1s.  Last read position: 15:101,914,783
INFO    2020-05-03 21:46:30 SinglePassSamProgram    Processed    19,000,000 records.  Elapsed time: 00:00:39s.  Time for last 1,000,000:    1s.  Last read position: 13:30,077,476
INFO    2020-05-03 21:46:31 SinglePassSamProgram    Processed    20,000,000 records.  Elapsed time: 00:00:40s.  Time for last 1,000,000:    1s.  Last read position: 13:67,283,295
INFO    2020-05-03 21:46:32 SinglePassSamProgram    Processed    21,000,000 records.  Elapsed time: 00:00:41s.  Time for last 1,000,000:    1s.  Last read position: 13:101,581,365
INFO    2020-05-03 21:46:34 SinglePassSamProgram    Processed    22,000,000 records.  Elapsed time: 00:00:43s.  Time for last 1,000,000:    1s.  Last read position: 12:19,991,021
INFO    2020-05-03 21:46:35 SinglePassSamProgram    Processed    23,000,000 records.  Elapsed time: 00:00:44s.  Time for last 1,000,000:    1s.  Last read position: 12:72,089,458
INFO    2020-05-03 21:46:36 SinglePassSamProgram    Processed    24,000,000 records.  Elapsed time: 00:00:45s.  Time for last 1,000,000:    1s.  Last read position: 12:111,892,434
INFO    2020-05-03 21:46:38 SinglePassSamProgram    Processed    25,000,000 records.  Elapsed time: 00:00:47s.  Time for last 1,000,000:    1s.  Last read position: 11:6,319,644
INFO    2020-05-03 21:46:39 SinglePassSamProgram    Processed    26,000,000 records.  Elapsed time: 00:00:48s.  Time for last 1,000,000:    1s.  Last read position: 11:40,523,478
INFO    2020-05-03 21:46:40 SinglePassSamProgram    Processed    27,000,000 records.  Elapsed time: 00:00:49s.  Time for last 1,000,000:    1s.  Last read position: 11:58,206,297
INFO    2020-05-03 21:46:41 SinglePassSamProgram    Processed    28,000,000 records.  Elapsed time: 00:00:50s.  Time for last 1,000,000:    1s.  Last read position: 11:70,796,276
INFO    2020-05-03 21:46:43 SinglePassSamProgram    Processed    29,000,000 records.  Elapsed time: 00:00:52s.  Time for last 1,000,000:    1s.  Last read position: 11:86,014,974
INFO    2020-05-03 21:46:44 SinglePassSamProgram    Processed    30,000,000 records.  Elapsed time: 00:00:53s.  Time for last 1,000,000:    1s.  Last read position: 11:99,794,025
INFO    2020-05-03 21:46:45 SinglePassSamProgram    Processed    31,000,000 records.  Elapsed time: 00:00:54s.  Time for last 1,000,000:    1s.  Last read position: 11:116,711,934
INFO    2020-05-03 21:46:46 SinglePassSamProgram    Processed    32,000,000 records.  Elapsed time: 00:00:55s.  Time for last 1,000,000:    1s.  Last read position: 9:21,552,765
INFO    2020-05-03 21:46:47 SinglePassSamProgram    Processed    33,000,000 records.  Elapsed time: 00:00:56s.  Time for last 1,000,000:    1s.  Last read position: 9:48,297,510
INFO    2020-05-03 21:46:49 SinglePassSamProgram    Processed    34,000,000 records.  Elapsed time: 00:00:58s.  Time for last 1,000,000:    1s.  Last read position: 9:64,023,963
INFO    2020-05-03 21:46:50 SinglePassSamProgram    Processed    35,000,000 records.  Elapsed time: 00:00:59s.  Time for last 1,000,000:    1s.  Last read position: 9:78,326,860
INFO    2020-05-03 21:46:51 SinglePassSamProgram    Processed    36,000,000 records.  Elapsed time: 00:01:00s.  Time for last 1,000,000:    1s.  Last read position: 9:95,357,520
INFO    2020-05-03 21:46:52 SinglePassSamProgram    Processed    37,000,000 records.  Elapsed time: 00:01:01s.  Time for last 1,000,000:    1s.  Last read position: 9:115,949,908
INFO    2020-05-03 21:46:54 SinglePassSamProgram    Processed    38,000,000 records.  Elapsed time: 00:01:03s.  Time for last 1,000,000:    1s.  Last read position: 14:20,641,844
INFO    2020-05-03 21:46:55 SinglePassSamProgram    Processed    39,000,000 records.  Elapsed time: 00:01:04s.  Time for last 1,000,000:    1s.  Last read position: 14:46,703,883
INFO    2020-05-03 21:46:56 SinglePassSamProgram    Processed    40,000,000 records.  Elapsed time: 00:01:05s.  Time for last 1,000,000:    1s.  Last read position: 14:64,114,566
INFO    2020-05-03 21:46:57 SinglePassSamProgram    Processed    41,000,000 records.  Elapsed time: 00:01:06s.  Time for last 1,000,000:    1s.  Last read position: 14:112,765,876
INFO    2020-05-03 21:46:59 SinglePassSamProgram    Processed    42,000,000 records.  Elapsed time: 00:01:08s.  Time for last 1,000,000:    1s.  Last read position: 10:39,959,560
INFO    2020-05-03 21:47:00 SinglePassSamProgram    Processed    43,000,000 records.  Elapsed time: 00:01:09s.  Time for last 1,000,000:    1s.  Last read position: 10:79,325,780
INFO    2020-05-03 21:47:01 SinglePassSamProgram    Processed    44,000,000 records.  Elapsed time: 00:01:10s.  Time for last 1,000,000:    1s.  Last read position: 10:93,352,283
INFO    2020-05-03 21:47:03 SinglePassSamProgram    Processed    45,000,000 records.  Elapsed time: 00:01:12s.  Time for last 1,000,000:    1s.  Last read position: 10:127,985,372
INFO    2020-05-03 21:47:04 SinglePassSamProgram    Processed    46,000,000 records.  Elapsed time: 00:01:13s.  Time for last 1,000,000:    1s.  Last read position: 8:44,215,935
INFO    2020-05-03 21:47:05 SinglePassSamProgram    Processed    47,000,000 records.  Elapsed time: 00:01:14s.  Time for last 1,000,000:    1s.  Last read position: 8:86,455,511
[Sun May 03 21:47:06 EDT 2020] picard.analysis.CollectAlignmentSummaryMetrics done. Elapsed time: 1.27 minutes.
Runtime.totalMemory()=995098624
To get help, see http://broadinstitute.github.io/picard/index.html#GettingHelp
Exception in thread "main" htsjdk.samtools.FileTruncatedException: Premature end of file: /Users/tsopoulidis/bam_files/Finnley_et_al_mm9_UCSC/SRR4423430.fastqAligned.sortedByCoord.out.bam
    at htsjdk.samtools.util.BlockCompressedInputStream.processNextBlock(BlockCompressedInputStream.java:530)
    at htsjdk.samtools.util.BlockCompressedInputStream.nextBlock(BlockCompressedInputStream.java:468)
    at htsjdk.samtools.util.BlockCompressedInputStream.readBlock(BlockCompressedInputStream.java:458)
    at htsjdk.samtools.util.BlockCompressedInputStream.available(BlockCompressedInputStream.java:196)
    at htsjdk.samtools.util.BlockCompressedInputStream.read(BlockCompressedInputStream.java:331)
    at java.base/java.io.DataInputStream.read(DataInputStream.java:148)
    at htsjdk.samtools.util.BinaryCodec.readBytesOrFewer(BinaryCodec.java:421)
    at htsjdk.samtools.util.BinaryCodec.readBytes(BinaryCodec.java:394)
    at htsjdk.samtools.util.BinaryCodec.readBytes(BinaryCodec.java:380)
    at htsjdk.samtools.BAMRecordCodec.decode(BAMRecordCodec.java:282)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.getNextRecord(BAMFileReader.java:866)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:840)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:834)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:802)
    at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:574)
    at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:553)
    at picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:149)
    at picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:94)
    at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:305)
    at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:103)
    at picard.cmdline.PicardCommandLine

.main(PicardCommandLine.java:113)