This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to replace/fill "Ns" in fasta with reference file having same coordinates

Dear community,

Hope you are doing great. As asked in title, please guide if there is any way to fill or replace N or N's in fasta file with the help of reference file.

For example

INPUT

Fasta with Ns

>fasta1
ACTGGCATCATGNNNNACTTTTGACC

Reference Fasta

>reference
ACTGGCATCATGTCAGACTTTTGACC

OUTPUT

>fasta1
ACTGGCATCATG**TCAG**ACTTTTGACC

I will really appreciate any help in this regard

Kind regards Ad

awk sed fasta
• 3,234 views • link
updated by shenwei356 shenwei356 • written by Adnan • Adnan

you have to explain how your problem is different from cp ref.fa user.fa

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

It is different in a way that it is exactly/completely copying the complete ref.fa into user.fa. However, what I want is manipulation at "N" regions only. For example: my ref file =ACTGGCATCATGTTTTACTTTTGACC and user file is=ACTGGCATCATGNNNNACTTTTGACC. So i want only Ns to be replaced by TTTT [as specified in reference] and not change any other characters. Hope it answers your query

• 0 views • link
written by Adnan • Adnan

Is the each entry in the "Fasta with Ns" always going to be exactly the same length as the equivalent entry in the "reference fasta"?.

• 0 views • link
written by i.sudbery i.sudbery

Yes, its the same. coordinates wise. However the length of Ns might be different across the complete FASTA

• 0 views • link
written by Adnan • Adnan

1 answer

I assume the query file has only one short sequence, neither contigs/scaffolds nor the whole assembly.

Here's a semi-automatic way:

  1. Searching in the reference

     seqkit locate --degenerate --pattern-file test.fasta ref.fasta 
 seqID   patternName     pattern strand  start   end     matched
 reference       fasta1  ACTGGCATCATGNNNNACTTTTGACC      +       7       32      ACTGGCATCATGTCAGACTTTTGACC

  2. Replacing queries with matched sequences

     seqkit replace --by-seq -p ACTGGCATCATGNNNNACTTTTGACC -r ACTGGCATCATGTCAGACTTTTGACC test.fasta
 >fasta1
 ACTGGCATCATGTCAGACTTTTGACC

However the length of Ns might be different across the complete FASTA

If there are lots of records, a script is needed. For every record:

  1. Extract subsequences around N+
  2. Index on the reference using the subsequences.
  3. Return the subsequences on the ref.
• 0 views • link
written by shenwei356 shenwei356

Log in to answer this question.

More posts like this