Thank you!
• 0 views
•
link
I am trying to align unmapped reads in a whole human genome sequence to viral genomes. I stumbled across NCBI's repository of reference genomes at the link below:
https://www.ncbi.nlm.nih.gov/genome/browse/#!/overview/
Is there a way I can download the FASTA sequences for each of these reference genomes? I would only need DNA based viruses, and ones that infect humans
Take a look at this report file for viral genomes.
I would only need DNA based viruses, and ones that infect humans
You can filter/parse out entries you need from it. Then download the genome sequence using EntrezDirect:
$ efetch -db nuccore -id NC_030449.1 -format fasta
>NC_030449.1 Unidentified circular ssDNA virus, complete genome
AAGTTCTGAGCGTAGGGCTAGTAGATAACGCACGTAGCTCAGATGACCGACGAAGACGGTCCTCGAGTAA
GAAACATAGTATTCATCATCAACGCAATCGATGGGGACGACCTTGTGTCCCAATTGCGTTTGCTCGATTT
CCAACACCCCACGTGGAAGCACGTAAAGTACTGTATCTATCAGCGAGAGTGCGGGGGTGAGGAGAATCGA
ATCCACTTCCAGGGCTACATGGAGTTCCACATCCAGCAGACCTATAAGCAGATTCATGCCATGGAAGGGA
Thank you!
Log in to answer this question.
you already asked many questions on this forum Is it possible for a single DNA nucleotide to match its cDNA complement, and not invert? ; What tool to take a FASTA sequence and output the amino acid chain? ; How can I isolate a particular DNA nucleotide from an SNP VCF file by specifying a GRCh37 location?; Is it possible to construct a full genome from whole sequence VCF files containing snp, indel, sv, cnv data? ; Looking for a specific heterozygous sequence variation (Lys170Stop) in a particular gene; I have a VCF file; without validating any answer " If the answer resolved your question, you should mark it as accepted. If an answer was not really helpful or did not work, provide detailed feedback so others to analyze that answer deeper. "
Thank you for the feedback, I just went back and validated all helpful answers from my previous questions