Download FASTA sequences for known viral reference genomes
I am trying to align unmapped reads in a whole human genome sequence to viral genomes. I stumbled across NCBI's repository of reference genomes at the link below:
https://www.ncbi.nlm.nih.gov/genome/browse/#!/overview/
Is there a way I can download the FASTA sequences for each of these reference genomes? I would only need DNA based viruses, and ones that infect humans
1 answer
Take a look at this report file for viral genomes.
I would only need DNA based viruses, and ones that infect humans
You can filter/parse out entries you need from it. Then download the genome sequence using EntrezDirect:
$ efetch -db nuccore -id NC_030449.1 -format fasta
>NC_030449.1 Unidentified circular ssDNA virus, complete genome
AAGTTCTGAGCGTAGGGCTAGTAGATAACGCACGTAGCTCAGATGACCGACGAAGACGGTCCTCGAGTAA
GAAACATAGTATTCATCATCAACGCAATCGATGGGGACGACCTTGTGTCCCAATTGCGTTTGCTCGATTT
CCAACACCCCACGTGGAAGCACGTAAAGTACTGTATCTATCAGCGAGAGTGCGGGGGTGAGGAGAATCGA
ATCCACTTCCAGGGCTACATGGAGTTCCACATCCAGCAGACCTATAAGCAGATTCATGCCATGGAAGGGA
Log in to answer this question.
More posts like this
-
alignement of human cells infected with a virus
written by hajar •
-
Creating BLASTN database for viruses
written by emiliomastriani •
-
How to create a merged human host viral RefSeq?
written by MatStat
-
Where can I download genomes of Retroviruses?
written by caggtaagtat
-
How to download all sequences of a list of proteins for a particular organism
written by traviata •
-
Retrieve genbank viral genomes
written by erwan.scaon
-
Plant viruses sequences are found in human brain Rna-seq sample: how to evaluate it?
written by Tao
-
the latest human reference genome fasta file
written by hana
-
Download All The Bacterial Genomes From Ncbi
written by rehma.ar •
-
Common Viral Dna In Human Sequencing Samples?
written by Ahdf-Lell-Kocks •
you already asked many questions on this forum Is it possible for a single DNA nucleotide to match its cDNA complement, and not invert? ; What tool to take a FASTA sequence and output the amino acid chain? ; How can I isolate a particular DNA nucleotide from an SNP VCF file by specifying a GRCh37 location?; Is it possible to construct a full genome from whole sequence VCF files containing snp, indel, sv, cnv data? ; Looking for a specific heterozygous sequence variation (Lys170Stop) in a particular gene; I have a VCF file; without validating any answer " If the answer resolved your question, you should mark it as accepted. If an answer was not really helpful or did not work, provide detailed feedback so others to analyze that answer deeper. "
Thank you for the feedback, I just went back and validated all helpful answers from my previous questions