How can i get sequences from a big list of accession number from NCBI?
1 answer
Using EntrezDirect. Sequences truncated for brevity. Use appropriate database.
$ more id.txt
NC_021708
NC_019498
NC_019944
$ cat id.txt | epost -db nuccore -format acc | efetch -format fasta
>NC_021708.1 Cuban alphasatellite 1 complete sequence, isolate 1_1
ACCCCGCCTCGTGCCATCTCTCCGTGCCATTGACTGGTCAATGGCTGTGGGTTTTTAAGGGCGTGCCGTC
--
>NC_019944.1 Okra enation leaf curl alphasatellite, complete sequence
AAGCTTTGGCCCCTGCGCACTTTAACCTTTGGCCCCTATAAATATATTTGTGCTGAGGCCGGATCATAGT
--
>NC_019498.1 Dragonfly-associated alphasatellite isolate PR_NZ48_2009, complete sequence
ACCCGCTTCGTTCCGTTTCCTCCTTGTTCCGGTATTTAAGCCTCCGCTTCTTTCATTTCTGGCTTCCTTT
Log in to answer this question.
More posts like this
-
Problem with Accession Number Changes in UniProt FASTA Sequences
written by bioinfo_enthusiast •
-
Web scraping in the KEGG db
written by bpvalderrama •
-
Obtaining FASTA format from blastp output
written by mbrav005 •
-
Retrieve CDS sequence from XP accession number
written by catarina.tserrano •
-
How to retrieve protein sequences from FASTA by using accession number?
written by gaiboyan23 •
-
Filtering sequences from a Fasta file using Biopython
written by tpaisie
-
Retrieving batch of selected regions sequences from a NCBI db
written by emilia.skirmuntt •
-
How to replace Accession Number for GI in a fasta header
written by marcelavillegasp •
-
Using BioPython to get sequences
written by jolespin
-
Metagenomic Assembler For Windows
written by marcia.astorga •
