I have bam file that I must convert to bed file to filter specific reads. Now I need to convert output bed to bam file. I am using bedToBam. As an output I have bam file but when I visualize it I see that sequences are in headers.
When I export it to txt. file I get:
TAATCACCAGCCTGACTGGCCGGGACAAAAACCAAGTGGAGGGCGAGATTCAGATCGTGTCAACTGCTGCCCAGACCTTCCTGGCAACGTGCATCAACGGGGTATGCTGGACTGTCTACCACGGGGCCGGAACGAGGACCATTGCGTCACCCAAGGGTCCTGTCATCCAGATGTATACCAACGTGGACCAAGACCTCGTGGGCTGGCCCGCTCCGCAGGGTTCCCGTTC pos=3329 len=229 ??????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????? TTGACGCCCTGCACCTGCGGTTCCTCGGACCTCTACCTGGTCACGAGGCACGCCGATGTCATCCCCGTGCGCCGGCGGGGTGATAGCAGGGGCAGCCTGCTTTCGCCCCGGCCCATTTCCTACTTGAAAGGCTCCTCGGGGGGTCCGCTGTTGTGCCCCGCGGGACACGCCGTGGGCATATTCAGGGCCGCGGTGTGCACC pos=3559 len=201 ??????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????
Is there any way to make this bed to bam conversion and get file with typical bam format ? Maybe there is an option fo filter headers containing sequences from my output bam and then using input bam, filter them in correct bam format?
•
written
by
kperlejewski •
1 answer
Bed files contain no extra metadata that would be relevant to a BAM file. By converting your BAM to bed you are losing all your mismatch, gap, and, sequence quality information. I somewhat can't imagine a scenario where you would be required to convert BAM files to bed files in order to do filtering. I would suggest you filter your BAM files directly.
You can subset BAM files by regions for instance: Extract Reads From A Bam File That Fall Within A Given Region
Log in to answer this question.
-
How to make bam from start pos of read 1 and end pos of read 2 from paired end bam files
written by genomics_student •
-
VEP annotated vcf is not readable in bcftools
written by Nai •
-
Overlapping CNVs against NSPs
written by ManuelDB
-
Invalid multibyte string R
written by DanK •
-
bedtools questions ! can't sort/index by samtools after bedToBam command
written by zhaizhaoyu7 •
-
How to convert vcf format with 0/0 0/1 1/1 to SNP
written by taoyan •
-
Miso - no events meet read coverage filter
written by willtun1991 •
-
problem in converting bcf file to bam file in bcfToBam
written by Madhuri Haque •
-
BED file with amplicon information
written by a.james
-
Convert BED(UCSC) to VCF
written by Ishtiaq Ahmad Khan
It looks like you deleted a prior question where you had shown how you did this conversion. Can you show us snippets of your BED, genome.size and resulting BAM file?
In any case it may be best to use the method that benformatics linked below in their answer.