CPC2.py can not work
Traceback (most recent call last): File "/home/data/vip55/software/CPC2-beta/bin/CPC2.py", line 6, in <module> import commands ModuleNotFoundError: No module named 'commands'
cpc2
• 1,585 views
•
link
updated
by
Nitin Narwade
168
• |
written
by
17318598206
3
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
ERROR with PRSKB
written by stefania.morelli92 0Good Afternoon everyone. I am using the PRSKB software by going to use the CLI tool with python, I have downloaded everything that is indicated …
-
error in coding potential calculator CPC2
written by Ashok 0CPC2.py -i SRR27190625.fasta -o SRR27190625_cpc2_out.txt I am facing problem while doing coding potential using cpc2. I don't why error is coming. Traceback (most recent call …
-
Kmergenie install bug
written by joshua.j.wright 1Hi All, I am currently trying to install/get kmergenie working on my Mac and I keep getting the same error: ``` Traceback (most recent call …
-
ModuleNotFoundError: No module named 'readfq' arises during the execution of kmergenie
written by yuanym 0$cat kmer_list_files D31-10A_1.qc.fq.gz D31-10A_2.qc.fq.gz $ kmergenie kmer_list_files --diploid /home/cdbi1/miniconda3/envs/gensize/bin/kmergenie:29: DeprecationWarning: pkg_resources is deprecated as an API. See https://setuptools.pypa.io/en/latest/pkg_resources.html import pkg_resources running histogram estimation list of …
-
GUIDEseq unsupported operand type(s)
written by 17318598206 3I am having this problem using the SAM file to identify the off-target $python /home/data/vip55/software/guideseq-master/guideseq/guideseq.py identify --aligned G2-1_S3_L004_R1_001.sam --genome /home/data/vip55/index/hg38/GRCh38.p13.genome.fa --outfolder ~/1work/guide-seq/L1-1-G4-2-0.5lane --target_sequence AGCCCCAGCAAGAGCACAAGAGG --description …
-
conda error
written by 17318598206 3Hi everyone, when I use conda to install packages, it shows error: ``` Collecting package metadata (current_repodata.json): failed # >>>>>>>>>>>>>>>>>>>>>> ERROR REPORT <<<<<<<<<<<<<<<<<<<<<< Traceback (most …
-
ImportError: No module named xgboos
written by Neel 2Hi, i am trying to run mic_prediction (https://github.com/PATRIC3/mic_prediction) tool and i also follow their manual still i am getting this error. If anyone know please …
-
configparser.NoOptionError: No option 'gene_regions' in section: 'mm10' : when use rgt-hint footpr…
written by 17318598206 3when i use rgt-hint footprinting: it's error: Traceback (most recent call last): File "/home/data/vip55/miniconda3/lib/python3.8/configparser.py", line 789, in get value = d[option] File "/home/data/vip55/miniconda3/lib/python3.8/collections/__init__.py", line 898, …
-
cvnkit: what is the problem here?
written by bk11 312cnvkit.py access cja.fa -s 10000 -o cja_targetsegment.bed Traceback (most recent call last): File "/home/bkhatri/cnvkit-master/cnvkit.py", line 8, in <module> from cnvlib import commands File "/gpfs_home/bkhatri/cnvkit-master/cnvlib/__init__.py", line …
-
Biopython: ImportError: No module named TreeConstruction
written by sivanc7 1Hi to all! Someone knows why I get the following error? ``` >>> from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor Traceback (most recent call last): File "<pyshell#6>", …
Maybe it is an installation error. The error message simply says the program
CPC2.pyis not able to find thecommandspackage in the python package list.Are you sure you installed
CPC2.pyand running it using the same python?