This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Tools for searching user-specified DNA consensous sequence

Hello,

I have a set of intergenic regions (from a non reference prokaryotic genome) and I am looking for a tool that look for the presence of DNA motifs like this one: TTGNCA 16-18 TAnnnT (16-18 is a spacer).

I stumbled upon the MEME suit and I was wondering if these tools can be used to perform this kind of analysis. Also, are you aware of any alternative to MEME?

Thank you!

meme
• 1,247 views • link
written by andres.firrincieli andres.firrincieli

Please post some example data (not image).

• 0 views • link
written by cpad0112 cpad0112

Not sure if I understand but here an example of the data. I have a multi fasta file whit my intergenic regions:

>NZ_CM002177_873
CGCAACCGCGTGCAGCCGATCGCCCCACGTCGGCGGTGGTTTCATCACGCTCCCTTCAATGCATCCGAGTATGGCGGCTGCTCTTCGCAGTTGAGGGTGTAGGGCTGGTCGGCGCGTCGGTGGCCGGGTCGGCCGGCGAGGTGCCGCCGGTCGGGGTCACCCGCCCTGTGCGCTGCTGCACGCCTTTCATTATGGGCGCGCGACGCACGACCGGCTCCGGCTGGGGTTGCCCTCG
>NZ_CM002177_1450
TCGAGGACTCCTCTGCTCCTGCCGCGTCATCCGCCGGCTCTTCTCTACGGCACCGCTCGAATGCCCAGCCCGATTGTGGCTCCGGCGCCCGACATGTGCTCGAGGTAGGGCGTCGCGACGGACCCGCAGAACCTCCTCGACGCTCTCCCCACGACCGCTTTCGCCTGTTGCGATGGACGGGTTCACCGGATTCGAGGCCGCCGCCGCGAAGAGCTCCCCGAGGCGGTCGCGGTCATGGCTCCCTTCCACCTTGCCCTCCTGGGCAAGCCGGCAGGGCCGCGTGGTGCCCCACCGTCGGCCTACGGTATAAATACATCTTGTGTCT
>NZ_CM002177_2417
CCGCTACTACCACCGACCCCGGTCGGCTGCCGACACTTACGGAAACGGTCCCGCGCGGGACGTGGCTGCTC

and a second file with the consensus sequences I need to find in the intergenic regions:

>cons1
GGGAACCnnnnnnnnnnnnnnnnnGTCNAA
>cons2
GGTXXnnnnnnnnnnnnnnnGGGTAF

X can be A or T while F can be C or T

Thank you

edit: MAST from the MEME suit did the job.

• 0 views • link
written by andres.firrincieli andres.firrincieli

0 answers

No answers yet.

Log in to answer this question.

More posts like this