This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Biopython blastn speed versus web query

I wonder if anyone can help me. I'm experiencing big performance problems when running a BLAST query in biopython. I have a sequence of about 1000 nt (see below) which I am trying to run blastn.

When I run this in biopython, occasionally I get something back in about 60 seconds [usually the first time I run it], but more often than not, it just seems to run forever

result_handle = NCBIWWW.qblast("blastn","nt",frag_2)
blast_record = NCBIXML.read(result_handle)

But when I paste the same sequence into the Blastn web tool directly, I get results back in about 15 seconds each time. Am I doing something wrong?

TGACCGGCGCGTTGTTGACGGTGGTGCCGTTGGTCGAATTCAGGTCCGACAGCAGCGCGGCATGCCCGTCGAAGCGCACCTCGAGGTGGCGGCGCGAGACGCCGGTATCGGGCAGACGGAACTGCGCGTCCTGACCGCGGCCGATCACATTGGTGCCCTCACGCAACTGGTACGTGCGTCCGCTGCCGTCGTCCAGCTGCAGGGTGACGGTGGTGCGACCGGCACCGGCGCCGCCTCCAGTGGGAGCGCCGTAGTCGGGGCTGCTCTGGTAGCCGCCGTGCTCGTAGTCGCCGTACTCGGGCTCGCCGTAACCGCCCTGAGGTGATCCGTAGCCGCCCTGCTGCGGCGGGGCGCCGTAGCCACCCTGCTGCGGGTAGGCCGGGGGACGACCGTAGTCCTGGCCCGGAGGCGGACCCTGCGGTGCGCCATAGCCACCGCCCTGTTCGTACTCGCCGTAGTTGGGACGAGGAGGCTCGCCGTACCCACCCTGTTGCGGCGGGGCGCCGTAGCCGCCCTGCTGCGGAGGTGCCGGGGGACGGCCGTATTCCTGACCGCCGCCATAGCCGCCCTGCTCATAGCCACCGCGGCCGCCTTGGTCGTAGCCACCCTGCTGTGGCGGGCGCTGTTGGTAGCCGCCCTGCTCATAGCCGGCCGGTGGGCGACCGTAATCCTGCCCGTACTGCTGGCCCTGCCCATATCCGCCCTGGCGCGGGGGGTATCCCTGGTCACCCTGCGGAGGCTGCTGACCACGTGGATCCTGTTCGGGACGTCCGTAGCGGTCGTCCTCTCGGCCGTACTCTTCGCCGGGGCGTCCCTGCTGGGGACCTGGGTTGTCAGTCATGGATGCTCCTGGTTGTGGATCCGGGGTCGAAGGGGCAGTCGTCACGGCGCCGTGCGTACGGTCCCGCTTGGTGTCGGGATTGACCACACCGCGCGTGCGAAACTGGCCGGTGTGCAAGTTCGGTGATTGTTCGAATCGGACAACAACTTCACCATACGT
blast biopython

you should also provide the cmdline (parameter settings you are using here).

Also keep in mind that the NCBI webblast likely uses different settings (and resources) than local blasts.

Hi, I'm not using cmdline. This is the full program essentially.

from Bio.Blast import NCBIWWW, NCBIXML result_handle = NCBIWWW.qblast("blastn","nt",frag_2) blast_record = NCBIXML.read(result_handle)

where frag_2 is the string of characters. My understanding was that this effectively calls the website (I don't have a local blast installed). As I say, it sometimes works, but more often than not, just looks like it's running for a long time (I suspect there may be an issue with the sleep settings)

OK, so you might be using default parameters.

If you are using the webblast extensively, keep in mind you are only allowed to run a number of jobs in parallel and also a max number of jobs a day (I think 100 ). If you violate those limits they will start putting you down in queue or ultimately block you.

0 answers

No answers yet.

Log in to answer this question.