NCBIStandalone package is missing

Hello, I am trying to follow the example pipeline here https://biopython.org/wiki/Phylo (at the end of the page). When I run the first cell:

from Bio.Blast import NCBIStandalone, NCBIXML
query_fname = "AAG35789.fasta"
result_handle, error_handle = NCBIStandalone.blastall(
    "/usr/bin/blastall", "blastp", "/db/fasta/swissprot", query_fname
)
blast_record = NCBIXML.read(result_handle)  

# This takes some time to run

I see that the package NCBIStandalone is not in Bio.Blast. How can I fix it? Thank you!

bio.phylo ncbistandalone biopython

• 1,566 views • link

updated 3.9 years ago by Sej Modha

• written 3.9 years ago by Valentin •

It seems that the error might be because the NCBIStandalone module has been deprecated, see the blog post below.

Code for calling standalone BLAST and parsing plain text output (DEPRECATED).

Source: https://homolog.us/Biopython/Bio.Blast.NCBIStandalone.html

• 0 views • link

written 3.9 years ago by Sej Modha

0 answers

No answers yet.

More posts like this

BlastX through Biopython
written 4.3 years ago by anasjamshed

I have an unknown gene segment in the Human_gene.txt file and I want to run blastx (translated nucleotide) using the blast module of Biopython by …
Biopython NcbiblastpCommandline not working: "No such file or directory: 'test.xml"
written 4.4 years ago by saubhiksom •

``` from Bio.Blast.Applications import NcbiblastpCommandline blastp=r"C:\NCBI\blast-BLAST_VERSION+\bin\blastp.exe" blastp_cline = NcbiblastpCommandline(blastp, query=r"C:/NCBI/blast-BLAST_VERSION+/bin/test.fasta", db=r'C:/NCBI/blast-BLAST_VERSION+/bin/bos_protein.fasta', outfmt=5, evalue=0.00001, out=r"C:/NCBI/blast-BLAST_VERSION+/bin/test.XML") blastp_cline from Bio.Blast import NCBIXML with open("test.XML") as result_handle: E_VALUE_THRESH=0.01 blast_records …
Parallelization of Biopython proccess
written 6.7 years ago by dllopezr •

Hi! I am working parsing blast xml outputs with Biopython and for performance purposes, I want to parallelize the process. The code takes a large …
Output FASTA from Biopython blast result
written 8.7 years ago by traviata •

I'm trying to use the Biopython wrapper for blastp to download matching protein sequences for some sequences that I have stored on my computer. I …
Help With BioPython BLAST Output
written 10.6 years ago by niamshah •

Hi, I am new to BioPython and am writing a program to BLAST human amino acid sequences. My search query is: ``` NCBIWWW.qblast( program="blastp", database="nr", …
blast against genomes in biopython
written 12.1 years ago by halima.loulou •

``` from Bio import Entrez, SeqIO from Bio.Blast import NCBIXML from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]') blast_records = NCBIXML.parse(result_handle) …
Problem Parsing Xml In Biopython
written 14.4 years ago by Amno •

Hi mates, I m new in python and I m trying to parse a result from local Blast...here the code. <pre><code>from Bio.Blast.Applications import NcbiblastpCommandline …
Windows Cmd Not Responding With Python Blastall 2.2.17
written 15.8 years ago by Niek De Klein

I'm using the standalone BLAST 2.2.17 with python. However, I'm having a problem with the cmd. When running the script the cmd stops responding at …
How To Parse Psiblast Results Using Biopython And Blast-2.2.24+?
written 15.9 years ago by Niek De Klein

I'm trying to run a PSIBlast program which selects certain sequences out at every round before it does the next iteration. For this I need …
Biopython Ncbistandalone Blastall Gives Different Result Than Calling Blastall Directly From Cmd
written 15.9 years ago by Niek De Klein

So, first I tested what results I should get from the blastall program using the command line, with e-value 0.001: <pre><code>C:\Niek\Test\blast-2.2.17\bin\blastall -p blastp -d C:\Niek\Test\arabidopsis-smallproteins.fasta …