blast against genomes in biopython
from Bio import Entrez, SeqIO
from Bio.Blast import NCBIXML
from Bio.Blast import NCBIWWW
result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]')
blast_records = NCBIXML.parse(result_handle)
for blast_record in blast_records:
for alignment in blast_record.alignments:
for hsp in alignment.hsps:
print(hsp.query[0:75] + '...')
print(hsp.match[0:75] + '...')
print(hsp.sbjct[0:75] + '...')
This does not give me an output, although the sequence is actually a sequence of the genome, so I must get a result. where is the error? the query is correct?
• 3,530 views
•
link
updated
by
Ram
•
written
by
halima.loulou •
•
written
by
halima.loulou •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
NCBIWWW.qblast returning empty XML
written by brandon •
-
Help searching homologs in a genome
written by ANDRES FELIPE •
-
No such file or directory: 'buccal_swab.unmapped1.fasta'
written by 정윤 •
-
Biopython NcbiblastpCommandline not working: "No such file or directory: 'test.xml"
written by saubhiksom •
-
BLAST using Biopython
written by a.lathifbt •
-
Want to loop through list of BLAST objects in python
written by westin.kosater •
-
BioPython BLAST Records HSP Sequences
written by samvanstroud •
-
how to parse blast in biopython
written by Breilly92 •
-
Python 3.4, Biopython 1.65:Screening out HSPs in .xml BLAST output where the subject and query are …
written by tyleraelliott •
-
Running Blastp From Biopython And Only Looking For Exact Matches
written by Hmm •
Are you sure you get a result? I guess that your result is empty, print the number of records and alignments received.
did you try "nt" instead of nr? try to remove/edit entrez_query.
in blast interface i get a result... the sequence is actually a sequence of
Beutenbergia cavernae DSM 12333 genome.. when i remove entrez_query it return result... i thing the entrz_query is wrong..There is no alignment.
This is cross-posted on SO. Either answer this yourself or delete it, so that it will not waste others' time.
Hello halima.loulou!
It appears that your post has been cross-posted to another site: http://stackoverflow.com/questions/24695028/blast-against-genomes-in-biopython
This is typically not recommended as it runs the risk of annoying people in both communities.
Hello halima.loulou!
We believe that this post is does not fit the main topic of this site.
closing
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!