This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to extract information about which chromosome it is, from bam file using pysam?

Hey! I am using pysam iterator like this:

alignments = pysam.AlignmentFile("file.bam", "rb")
for line in alignments.fetch(until_eof=True):
    print(line)
    break

Output looks like this:

HISEQ:157:HAM0GADXX:1:1101:1635:2143    16  15  73530482    42  102M    -1  -1  102 TGGTGGGAAGGTTTGCTCTTCACCAATTAACGAAGGATGGGTAAGGAAGTTAGTTGGTGGTTGGACTCTGCTCTCAGATTCAACCCTCCCTAGCCTTCTATT  array('B', [22, 33, 33, 33, 37, 37, 37, 37, 37, 37, 37, 37, 40, 40, 37, 37, 27, 37, 33, 33, 33, 27, 37, 37, 33, 37, 40, 40, 40, 40, 40, 40, 37, 40, 40, 40, 37, 33, 40, 40, 40, 40, 40, 40, 40, 37, 40, 40, 40, 40, 37, 37, 40, 37, 40, 37, 37, 27, 37, 37, 33, 37, 37, 33, 27, 37, 37, 37, 37, 37, 37, 37, 33, 37, 37, 37, 37, 33, 33, 33, 37, 37, 37, 37, 40, 40, 37, 33, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 33, 33, 33])    [('AS', 0), ('XN', 0), ('XM', 0), ('XO', 0), ('XG', 0), ('NM', 0), ('MD', '102'), ('YT', 'UU')]

I thought that chromosome number is on third position in line which in this example is 15, but after further analysis I think I am wrong. Maybe someone know? Kindly help.

pysam bam
• 3,351 views • link
updated by cpad0112 cpad0112 • written by ja4123 • ja4123

yes, it is 15.

but after further analysis I think I am wrong.

what is your "analysis" ?

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Later I saw something like for example "chr66" and then I noticed that on this position are numbers above 46. I am working on human sample.

• 0 views • link
written by ja4123 • ja4123 
> import pysam
> samfile = pysam.AlignmentFile("test.bam", "rb")
> [print(i.reference_name) for i in samfile]

Check if this gives you the result you expected.

• 0 views • link
written by cpad0112 cpad0112

Your code gives me all chromosemes from 1 to 23, X and Y, and some None. What does mean None, that it is not mapped? Also I received some other like in a header of sam file like: chrUn_gl000234, chr1_gl000191_random and some similar but not much. Do you know what does mean? Thanks for the answer.

• 0 views • link
written by ja4123 • ja4123

But in general I have got what I wanted. Thanks!

• 0 views • link
written by ja4123 • ja4123

Please refer to reference fasta file headers used in alignment (resulting in bam)

• 0 views • link
written by cpad0112 cpad0112

0 answers

No answers yet.

Log in to answer this question.

More posts like this