what if I start from 1st base of the alignment file and save all the bases in an array or a datastructure like that because I want to align these bases to reference genome.?? Is it right methodology??
I want to extract nucleotide per position out of a bam file in python using pysam module of python.
As i am a beginner so I want to ask that
Which part of bam file tells about position??
How to calculate nuleotides(A,T,G,C) present on this position(i.e what logic should be used) using python's pysam??
So anyone tell me about this.
The sample bam file and the code used to print it is shown below.
.
#!/usr/bin/python
import pysam
samfile = pysam.Samfile( "reads.sorted.bam", "rb" )
for line in samfile:
print(line)
The above code prints the bam file as follows.
72NUT:00012:01818 0 0 0 0 4M22I250M -1 -1 276 CCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTTTGGGGGGTATGCACGCGATAGCATTGCGGGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCATTATTTATCGCACCTACGTTCAATATTACAGGCGAGCATACTTACTAAAGCGTATTAATTAATTAATGCTTGTAGGACATAACAATAACAATTAAATGTCT array('B', [35, 32, 35, 32, 34, 34, 30, 34, 34, 32, 34, 34, 32, 34, 34, 34, 34, 33, 33, 33, 34, 34, 32, 33, 33, 34, 34, 34, 34, 34, 32, 34, 35, 35, 34, 33, 33, 34, 34, 35, 30, 34, 34, 34, 32, 34, 31, 34, 31, 34, 25, 25, 25, 34, 23, 23, 23, 11, 23, 22, 17, 25, 34, 35, 35, 32, 34, 34, 34, 34, 34, 34, 35, 30, 34, 32, 30, 30, 30, 34, 34, 24, 34, 34, 34, 34, 29, 34, 34, 34, 34, 34, 16, 34, 34, 30, 30, 26, 32, 32, 32, 34, 32, 32, 32, 30, 30, 29, 25, 26, 21, 26, 26, 25, 36, 27, 33, 31, 31, 26, 26, 26, 26, 30, 31, 31, 30, 36, 29, 30, 30, 30, 30, 31, 34, 26, 30, 30, 30, 33, 33, 33, 30, 30, 30, 31, 31, 31, 33, 30, 30, 30, 33, 33, 33, 33, 26, 33, 33, 33, 28, 32, 28, 32, 31, 31, 28, 31, 31, 31, 30, 30, 30, 24, 30, 34, 30, 35, 36, 35, 19, 26, 26, 26, 33, 33, 29, 30, 27, 30, 30, 30, 30, 25, 20, 15, 15, 11, 15, 15, 15, 18, 23, 23, 33, 33, 29, 26, 26, 26, 30, 30, 30, 29, 30, 30, 30, 28, 32, 32, 30, 30, 27, 11, 25, 23, 23, 25, 25, 33, 30, 33, 29, 33, 28, 31, 20, 25, 19, 25, 22, 27, 27, 31, 31, 17, 23, 23, 29, 27, 22, 27, 32, 25, 26, 25, 28, 32, 33, 21, 26, 26, 30, 26, 26, 23, 26, 30, 33, 33, 24, 30, 30, 30, 26, 26]) [('AS', -138), ('XN', 0), ('XM', 14), ('XO', 1), ('XG', 22), ('NM', 36), ('MD', '0G0A1C59C8G19A56T1T36A5C8T2G28T10G7'), ('YT', 'UU')]
72NUT:00158:00470 16 0 0 3 4M7I213M -1 -1 224 CACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGGGCTCTCCATGCATTTGGTATTTTCGTTTGGGGGGTATGCACGCGATAGCATTGCGGGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCATTATTTATCGCACCTACGTTCAATATTACAGGCGAGCATACTTACTAAAGCGTATTAATTAATT array('B', [21, 21, 22, 23, 14, 14, 9, 15, 15, 15, 23, 34, 23, 23, 17, 25, 25, 25, 23, 27, 27, 27, 25, 18, 26, 26, 26, 32, 28, 33, 30, 30, 21, 25, 25, 16, 16, 16, 22, 21, 9, 23, 23, 23, 23, 22, 22, 21, 30, 30, 29, 25, 25, 25, 23, 27, 17, 27, 23, 17, 23, 23, 23, 9, 23, 23, 23, 23, 27, 21, 38, 32, 11, 32, 32, 32, 32, 23, 28, 28, 28, 28, 29, 34, 34, 34, 34, 34, 34, 34, 30, 25, 23, 25, 17, 25, 25, 34, 27, 36, 35, 34, 34, 34, 34, 34, 32, 34, 34, 34, 31, 34, 31, 34, 34, 34, 34, 34, 29, 35, 34, 34, 34, 34, 34, 34, 30, 30, 36, 30, 30, 26, 30, 33, 33, 35, 25, 28, 25, 14, 25, 25, 23, 23, 17, 33, 30, 23, 25, 25, 20, 25, 23, 28, 35, 27, 21, 30, 30, 29, 22, 27, 23, 11, 23, 25, 25, 29, 29, 34, 36, 34, 32, 34, 30, 30, 30, 34, 31, 34, 34, 31, 35, 34, 34, 32, 34, 34, 34, 34, 32, 34, 34, 35, 35, 34, 34, 34, 34, 34, 34, 30, 31, 31, 26, 26, 15, 26, 26, 26, 34, 31, 34, 34, 31, 34, 32, 34, 31, 34, 31, 34, 32, 34]) [('AS', -85), ('XN', 0), ('XM', 13), ('XO', 1), ('XG', 7), ('NM', 20), ('MD', '0G1T0C32A26C8G19A56T1T36A5C8T2G10'), ('YT', 'UU')]
72NUT:00473:00766 0 0 0 0 4M12I165M1I19M1I15M1I2M1I22M1D35M1I28M -1 -1 307 GACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTTTGGGGGGTACGCACGCGATAGCATTGCGGGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCATTATTTATCGCACCTATCGTTCAATATTACAGGCGAGTCATACTTACTAAAGCTGATATTAATTAATTAATGCTTGTAGACATAACAATAACAATTAAATGTCTGCACAGCCGTCTTTCCACACAGACATCATAACAAAAAA array('B', [35, 34, 34, 34, 34, 35, 35, 35, 30, 31, 31, 34, 32, 34, 34, 34, 34, 34, 34, 34, 32, 34, 34, 34, 34, 34, 34, 30, 30, 30, 26, 30, 34, 34, 31, 34, 32, 34, 32, 35, 34, 32, 32, 34, 26, 25, 25, 14, 26, 25, 31, 31, 31, 31, 33, 26, 29, 29, 34, 34, 36, 34, 35, 30, 34, 32, 35, 34, 34, 34, 34, 24, 34, 34, 32, 33, 11, 23, 23, 23, 23, 23, 8, 23, 31, 34, 34, 34, 34, 34, 34, 34, 34, 29, 30, 30, 34, 34, 34, 34, 32, 30, 26, 26, 36, 24, 34, 34, 34, 34, 34, 35, 26, 29, 30, 31, 29, 29, 33, 35, 30, 26, 28, 34, 34, 29, 35, 35, 34, 32, 32, 36, 34, 35, 31, 31, 31, 34, 32, 33, 32, 34, 26, 29, 29, 34, 25, 30, 30, 34, 32, 34, 32, 34, 34, 35, 32, 34, 34, 34, 34, 33, 34, 26, 30, 30, 26, 29, 35, 36, 28, 26, 29, 34, 27, 14, 15, 14, 23, 26, 14, 14, 13, 13, 26, 8, 13, 13, 8, 19, 19, 34, 28, 34, 34, 34, 34, 28, 17, 17, 17, 17, 17, 19, 19, 19, 19, 17, 33, 20, 25, 30, 13, 29, 29, 21, 27, 14, 14, 14, 14, 13, 18, 19, 18, 18, 18, 32, 13, 17, 13, 16, 8, 16, 8, 16, 25, 30, 19, 6, 12, 12, 12, 12, 12, 20, 12, 12, 12, 18, 12, 17, 13, 17, 24, 18, 17, 24, 13, 17, 22, 33, 33, 14, 25, 25, 31, 25, 25, 17, 17, 31, 25, 13, 13, 13, 8, 12, 12, 12, 12, 18, 8, 12, 8, 16, 18, 18, 16, 16, 21, 32, 32, 30, 30, 30, 21, 19, 19, 25, 16, 12, 12, 12, 12, 12, 4]) [('AS', -147), ('XN', 0), ('XM', 13), ('XO', 7), ('XG', 18), ('NM', 31), ('MD', '2T0C59C8G0T18A56T1T36A5C11G20^G7T10G44'), ('YT', 'UU')]
72NUT:00541:01644 0 0 0 3 4M5I265M -1 -1 274 CGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTTTGGGGGGTATGCACGCGATAGCATTGCGGGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCATTATTTATCGCACCTACGTTCAATATTACAGGCGAGCATACTTACTAAAGCGTATTAATTAATTAATGCTTGTATGACATAACAATAACAATTAAATGTCTGCACAGCCGTCTTTC array('B', [36, 34, 34, 30, 30, 30, 31, 34, 34, 35, 34, 34, 34, 32, 30, 30, 30, 34, 34, 33, 29, 30, 29, 26, 29, 33, 34, 32, 34, 33, 35, 32, 34, 34, 34, 34, 34, 29, 26, 29, 26, 29, 27, 27, 31, 34, 35, 35, 32, 34, 31, 31, 30, 34, 34, 36, 30, 35, 31, 34, 34, 34, 35, 34, 25, 34, 34, 34, 36, 25, 26, 29, 26, 26, 26, 10, 26, 34, 34, 34, 34, 34, 30, 30, 30, 34, 34, 34, 30, 30, 30, 34, 34, 32, 34, 34, 34, 35, 29, 35, 36, 36, 34, 31, 30, 29, 30, 34, 34, 31, 34, 32, 34, 35, 35, 31, 31, 31, 28, 31, 34, 34, 37, 31, 31, 32, 39, 35, 31, 31, 31, 34, 34, 34, 30, 31, 31, 31, 37, 29, 34, 34, 34, 29, 30, 28, 30, 34, 34, 30, 34, 34, 34, 29, 30, 30, 27, 30, 35, 32, 34, 34, 34, 28, 30, 30, 34, 34, 34, 34, 35, 32, 34, 34, 29, 29, 29, 22, 26, 34, 29, 26, 26, 26, 28, 26, 26, 26, 25, 19, 25, 25, 25, 24, 19, 19, 19, 19, 17, 20, 30, 34, 34, 34, 34, 34, 29, 34, 29, 20, 17, 24, 24, 20, 20, 25, 23, 32, 35, 31, 30, 26, 30, 26, 30, 30, 30, 27, 11, 14, 15, 15, 14, 14, 14, 15, 27, 27, 29, 26, 31, 34, 32, 34, 35, 32, 34, 34, 31, 34, 31, 34, 34, 24, 25, 25, 25, 25, 25, 25, 25, 25, 31, 14, 14, 14, 21, 14, 14, 14, 26, 26, 8, 13]) [('AS', -101), ('XN', 0), ('XM', 19), ('XO', 1), ('XG', 5), ('NM', 24), ('MD', '0G0A0T0C59C8G19A56T1T36A5C8T2G20G7T10G16C0T2C1'), ('YT', 'UU')]
72NUT:00614:00539 16 0 0 0 3M17I77M1I160M -1 -1 258 TAACGAACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTTTGGGGGGTATGCACGCGGATAGCATTGCGGGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCATTATTTATCGCACCTACGTTCAATATTACAGGCGAGCATACTTACTAAAGCGTATTAATTAATTAATGCTTGTAGGACATAGCAATA array('B', [12, 8, 12, 12, 12, 8, 12, 12, 12, 21, 25, 24, 31, 34, 34, 29, 29, 30, 30, 34, 34, 34, 30, 30, 29, 35, 35, 35, 30, 31, 31, 26, 32, 26, 34, 32, 32, 32, 30, 33, 29, 33, 29, 27, 29, 30, 33, 33, 32, 30, 24, 30, 30, 25, 29, 29, 34, 29, 28, 20, 34, 20, 23, 29, 29, 34, 23, 36, 30, 21, 25, 25, 32, 22, 33, 32, 33, 34, 34, 29, 34, 34, 16, 36, 36, 38, 37, 38, 34, 30, 26, 26, 22, 22, 23, 23, 14, 9, 14, 14, 25, 31, 31, 33, 34, 32, 34, 33, 32, 26, 32, 31, 31, 31, 31, 31, 36, 30, 31, 34, 34, 32, 30, 29, 29, 29, 25, 25, 25, 24, 29, 25, 29, 33, 31, 28, 29, 30, 34, 34, 34, 34, 34, 34, 30, 30, 30, 35, 34, 34, 28, 34, 32, 25, 25, 17, 25, 17, 31, 31, 28, 26, 29, 30, 34, 34, 34, 30, 34, 34, 34, 31, 35, 35, 30, 35, 35, 34, 34, 34, 34, 34, 34, 32, 34, 34, 34, 34, 34, 32, 34, 34, 31, 34, 34, 34, 31, 34, 34, 34, 34, 32, 35, 34, 34, 34, 34, 34, 34, 34, 34, 34, 31, 35, 35, 34, 34, 28, 35, 34, 34, 34, 34, 34, 34, 31, 34, 31, 34, 33, 35, 32, 34, 32, 36, 33, 34, 30, 30, 30, 31, 34, 34, 34, 34, 32, 34, 34, 34, 35, 35, 34, 35, 34, 31, 34, 34, 32]) [('AS', -125), ('XN', 0), ('XM', 13), ('XO', 2), ('XG', 18), ('NM', 31), ('MD', '0G1T60C8G19A56T1T36A5C8T2G27A0T4'), ('YT', 'UU')]
2 answers
You're looking for the pileup() function, which is equivalent to samtools mpileup ....
You're describing a less memory efficient version of the what I suggested. Why waste time coding that when it already exists?
Thanks,
It works fine for printing bases per position.
But I want to save these bases per position in a datastructure.
I tried to use list or string but all the bases are saved singly like 'A','T','G','C','C','C' at postion 1,2,3,4,5,6 etc but i want it to be saved like 'A','T','G','CCC' at position 1,2,3,4
In short I want the datastructure to be indexed according to the base position and all the bases at that position should be stored at a single position.
I have used this code but it is not giving correct results.
import pysam
prot=' '
samfile = pysam.Samfile( "reads.sorted.bam", "rb" )
for pileupcolumn in samfile.pileup():
for pileupread in pileupcolumn.pileups:
if not pileupread.is_del and not pileupread.is_refskip:
prot = prot + 'pileupread.alignment.query_sequence[pileupread.query_position]'
And the output comes as 'A','T','G','C','C','C','C' not as intended 'A','T','G','CCCC'
pileupcolumn contains all of the alignments that overlap a particular position, annotated by the offset inside the alignment to the appropriate base. If you want to store the results in a particular data structure then just do it. prot would need to be a list that is appended to with a string created anew every time the for pileupread in pileupcolumn.pileups: is encountered.
I have tried this code
samfile = pysam.Samfile( "reads.sorted.bam", "rb" )
mystring = ''
mylist = []
for pileupcolumn in samfile.pileup():
for pileupread in pileupcolumn.pileups:
if not pileupread.is_del and not pileupread.is_refskip:
mystring = mystring + pileupread.alignment.query_sequence[pileupread.query_position]
for pileupcolumn in samfile.pileup():
mylist =mylist + [mystring[pileupcolumn.pos:pileupcolumn.pos+pileupcolumn.n]]
But it is not working right and has following issues:
- Length of the list i.e len(mylist) is 16568 whereas total base positions in the bam file were 16567.
- It works rightly for only few indices i.e for first 8 positions where it gives 'G', 'A', 'T', 'C', 'A', 'C', 'A', 'GGG', 'GGG'
- But for next postions it gives wrong output as 'GGG', 'GGGTT', 'GGTTT', 'GTTTCC', 'TTTCCCC', 'TTCCCCC', 'TCCCCCT', 'CCCCCTT', 'CCCCTTT'
- Whereas the coverage in bam file is
cvrge at base 0 = 1
Rev G
cvrge at base 1 = 1
Rev A
cvrge at base 2 = 1
Rev T
cvrge at base 3 = 1
Rev C
cvrge at base 4 = 1
Rev A
cvrge at base 5 = 1
Rev C
cvrge at base 6 = 1
Rev A
cvrge at base 7 = 3
Rev G
Fwd G
Fwd G
cvrge at base 8 = 3
Rev G
Fwd G
Fwd G
cvrge at base 9 = 3
Rev T
Fwd T
Fwd T
cvrge at base 10 = 5
Rev C
Fwd C
Fwd C
Fwd C
Rev C
cvrge at base 11 = 5
Rev T
Fwd T
Fwd T
Fwd T
Rev T
cvrge at base 12 = 6
Rev A
Fwd A
Fwd A
Fwd A
Rev A
Fwd A
cvrge at base 13 = 7
Rev T
Fwd T
Fwd T
Fwd T
Rev T
Fwd T
Rev T
cvrge at base 14 = 7
Rev C
Fwd C
Fwd C
Fwd C
Rev C
Fwd C
Rev C
cvrge at base 15 = 7
Rev A
Fwd A
Fwd A
Fwd A
Rev A
Fwd A
Rev A
cvrge at base 16 = 7
Rev C
Fwd C
Fwd C
Fwd C
Rev C
Fwd C
Rev C
cvrge at base 17 = 7
Rev C
Fwd C
Fwd C
Fwd C
Rev C
Fwd C
Rev C
Please post an example BAM file somewhere, noting an example region where you program isn't showing the results you expect.
This looks like an XY problem, what exactly do you want to achieve and what is the aim of this analysis?
- In order to get two separate list for positive and negative strands ,I have used this code that will extract two lists having bases at positions according to the coverage file as follows
`
NegativeList = ['G','A','T','C','A',........]
PositiveList = ['-','-','-','-','-','-','G','G','G'........]
`
This code puts '-' where a base is not present ,
`
ReverseList = ['-'] * 16570 ForwardList = ['-'] * 16570 with open('gattaca.txt','r') as file: for line in file: if 'CVRGE' in line.upper(): count = int(line.split('=')[-1].strip()) base = int(line.split('=')[0].strip().split(' ')[-1]) if 'REV' in line.upper(): if '-' in ReverseList[base]: ReverseList[base] = line.rstrip()[-1] else: ReverseList[base] += line.rstrip()[-1] if 'FWD' in line.upper(): if '-' in ForwardList[base]: ForwardList[base] = line.rstrip()[-1] else: ForwardList[base] += line.rstrip()[-1]`
Its working rightly but I want to ask that if there is any more efficient way to achieve that ??
Why not just directly do that in the original script?
I tried to do it using pysam but it resulted in very absurd results ,
Can you help write code to achieve the above mentioned results i.e to save coverage data from negative and positive strands in negative and positive lists that are indexed according to the number of bases.?
Also tell if this can result in improving the efficiency ??
The only way to make it more efficient would be to write it in C, which would take more time than it's worth for you. You can figure out how to do this yourself, just make a small test file so you can run (and therefore debug) things quickly and easily.
I finally figured it out using this code which works fine for me i.e instead of creating a new file from pileup() extract the strand based coverage from within the loop for pileup() function, the code is given below,
samfile = pysam.Samfile( filename, "rb" )
ReverseList = [''] * lenref #where lenref is length of reference passed as an argument
ForwardList = [''] * lenref
for pileupcolumn in samfile.pileup() :
if (pileupcolumn.n <= 3):
continue
for pileupread in pileupcolumn.pileups:
if not pileupread.is_del and not pileupread.is_refskip:
if pileupread.alignment.is_reverse: #negative
ReverseList[pileupcolumn.pos] += pileupread.alignment.query_sequence[pileupread.query_position]
else:
ForwardList[pileupcolumn.pos] += pileupread.alignment.query_sequence[pileupread.query_position]
But know I am stuck in a new problem i.e how to filter bam file based on mapping qualities which I have asked here here.
The following produces the correct nucleotide distribution per-base. If you're getting something else, then it's because you're coding it wrong.
#!/usr/bin/env python
import pysam
samfile = pysam.Samfile("reads.sorted.bam", "rb")
mystring = ''
mylist = []
for pileupcolumn in samfile.pileup("gi|251831106|ref|NC_012920.1|"):
mystring = ''
for pileupread in pileupcolumn.pileups:
if not pileupread.is_del and not pileupread.is_refskip:
mystring = mystring + pileupread.alignment.query_sequence[pileupread.query_position]
mystring = "".join(sorted(list(mystring))) # Sort alphabetically
mylist.append((pileupcolumn.pos+1,mystring))
samfile.close()
for (k, v) in mylist:
print("{}: {}".format(k, v))
Log in to answer this question.