This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Plot nucleotide diversity with multiple sequence alignment

I have a fasta file containing sequence alignements and i woud like to plot the nucleotide divergence along the sequence positions

I have tried using DNAsp and popgenome in R but it is not really working.

The problem is that i have regions with long gaps in some sequences and i want a tool which do not calculate diversity with sequences containing gaps at a specific position but instead consider other sequences in this region without gaps ?

Can anyone suggest me a tool ? Thanks in advance, and if I missed explaining anything, please let me know!

msa sequencealignement sequencediversity

Remove the sequences with gaps and feed the rest to sequence logos. or replace the gaps with zeros and feed the MSA to sequence logos. Without example data, and expected output, it would be difficult to address your post.

Thanks for the answer ! I'm actually analysing Tansposable elements which are around 150 bp and some of them have long deletions. Here are is a sample data :

> seq 1

-ggctcgtttggcgcagctccagctcctgattctaagcgaggatctgga---ggagccgtgccaaacgagtattttttt--
aaattgattctcgtgtggagccgaaagatcgggagtcgtttttgtgaagaaaggtgggatct-aaaaaaacctgctccaccctcctttaaaacagctcctcaaccaaccaaatatggacatccccttaaagtttgatc
gaaattactcggaattgccattggacaaaaacataacgagccaatttatggattaaacatttgaggccattttatg
cactactatgatggaaatattttatatgttattgtttcatattttttt--

 > seq 2

---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------tggacctccccttaaagtttgatcgaaattacccgcaattgctattggacaaaaacataacgagccaatttatggattaaaca
tttgagaccattttatgcactactacgatgagaatattttatatgttattgtttcatattttttt--

I would like to get this kind of output to identify regins with low diversity: enter image description here

I have exactly the same problem, my multiple alignment is too big for DnaSP and PopGenome seems bugged. Did you find a solution?

0 answers

No answers yet.

Log in to answer this question.