*Hi all! I know that there are some similar topics and I read them but it didn’t solve my issue…

I’m working with smRNA-seq data (plants) and my aim is to find novel and known miRNAs, then perform DE expression analysis and find some correlations between miRNA and mRNA expression profiles.

I preprocced smRNA reads: 1) trimmed adapters using Illumina documentation I found only one adapter sequence actually and removed it with cutadapt. Command:

~/.local/bin/cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o trimmed.fq.gz in.fq.gz

98.5% reads with adapters, 41,2% total written

2) then I filtered tRNA and rRNA contamination using bbduk.sh

3) kept reads that are from 19 to 26 nt using cutadapt

Original reads: 17 483 425 sequences Clean reads: 6 592 972 sequences

And here is the issue. I aligned my clean reads against precursor miRNA sequences downloaded from mirbase to identify known miRNAs. I used both bowtie and bbduk.sh but alignment rate is very low, about 5%. What could cause it?