error in bowtie2 alignment
1
0
Entering edit mode
7.3 years ago
prasoonagar ▴ 10

Hi I have done the trimming of my reads using cutadapt after trimming i did FASTQC and find that three modules

  • Per Base Sequence Content
  • Over represented sequences
  • Sequence Length Distribution
  • Per Sequence GC Content
  • Kmer Content

they all failed. But I still went ahead and tried aligning the reads using bowtie2 with the following command

bowtie2 -p 8 -x ../hg38_index/index -X 300 --no-unal --time --no-mixed --local --dovetail --very-sensitive -1 Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R1.fastq.gz -2 Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R2.fastq.gz -S Lmin6-ChIP-41650664/Lmin6_chip.sam

I got the following error with the bowtie2

Warning: minimum score function gave negative number in --local mode for mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 2:N:0:CGATGT; setting to 0 instead
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 1:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 2:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 1:N:0:CGATGT' because it was < 2 characters long
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 2:N:0:CGATGT' because it was < 2 characters long
Warning: minimum score function gave negative number in --local mode for mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 1:N:0:CGATGT; setting to 0 instead
Warning: minimum score function gave negative number in --local mode for mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 2:N:0:CGATGT; setting to 0 instead
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 1:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 2:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 1:N:0:CGATGT' because it was < 2 characters long
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 2:N:0:CGATGT' because it was < 2 characters long
Warning: minimum score function gave negative number in --local mode for mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:14918:13429 1:N:0:CGATGT; setting to 0 instead
Warning: minimum score function gave negative number in --local mode for mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:14918:13429 2:N:0:CGATGT; setting to 0 instead

I tried another thing did the alignment using the untrimmed files and then the command worked perfectly. so want some suggestion if I did any thing wrong in the trimming. I used the following command for trimming

~/.local/bin/cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \
-o Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R1.fastq.gz \
-p Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R2.fastq.gz Lmin6-ChIP-41650664/Lmin6-ChIP_S1_L001_R1_001.fastq.gz   Lmin6-ChIP-41650664/Lmin6-ChIP_S1_L001_R2_001.fastq.gz

I will be happy if some kind suggestions are there for this problem.

Thanks

bowtie2 alignment cutadapt • 6.6k views
ADD COMMENT
4
Entering edit mode
7.3 years ago

I don't see a problem. You got warnings, not errors. Probably, it's because you have some very short reads after trimming; you can remove those if you want, which might make the warnings go away. With the BBMap package, you would do this:

reformat.sh in=Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R#.fastq.gz out=filtered#.fq.gz minlen=30
ADD COMMENT
2
Entering edit mode

cutadapt can be run in paired end mode and told to drop pairs where one read is shorter than a certain length. I generally drop anything shorter than 15 or 20bp

ADD REPLY
0
Entering edit mode

Thanks for your suggestions i think you are right but one more query the warning says that skipping mate means they were already dropped during the alignment???

ADD REPLY
1
Entering edit mode

It looks like those are length-0 reads. Not much there to align :)

ADD REPLY
0
Entering edit mode

Hi Brian, I had a similar warnings for many many reads in my log file: Warning: skipping read #### because length (1) <= # seed mismatches (0) Warning: skipping read #### because it was < 2 characters long. I was using kneaddata with bowtie2.

My question is that how to find out if I really have many short reads and if the number is high how to tackle the issue?

Hope you can help me with this.

Looking forward to your reply. thank you

ADD REPLY
0
Entering edit mode

Dear pdhrati02 Given the age of this question and the slight difference in your question, I think you would be better off starting a new question.

ADD REPLY

Login before adding your answer.

Traffic: 2160 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6