Genomics Coordinates From Sequences

hi all, i have a set of sequences such as

GTGAGCACTCATGAACAGTCTGAGTCCGCCCATGGACGCACAGGGCCCAGCACTG(G-C)AGGAAGACAAAGATCCCGCCACGAGCAGGCACGAGACAGCTCCAGGCACTCAGCGT

what i want is the genomics coordinates for the location of the SNP. I want to use those coordinates to query microarray data and VCF data.

any resources online that will allow for such batching.

thanks in advance.

genomic

• 2,158 views • link

updated 12.6 years ago by swbarnes2

• written 12.6 years ago by win

1 answer

Use BLAST, or a short-read aligner, if you have one.

• 0 views • link

written 12.6 years ago by swbarnes2

Just use the WT (without the SNP) sequence or enable at least one mismatch if you use a short read aligner.

• 0 views • link

written 12.6 years ago by IV

More posts like this

Filter unique SNPs (rows) in VCF/text file
written 6.7 years ago by evelyn

Dear all, I want to filter for unique SNPs. For example, these two different positions have the same SNPs called `A C C`. So I …
RealignerTargetCreator (GATK) contig issue
written 8.5 years ago by win

So i downloaded a .bam from phase 3 1000 genomes and i want to run the RealignerTargetCreator on it using GATK 3.8. The following command …
VCF with SnpEff and gene name annotations
written 8.6 years ago by win

hi all, i am looking for a well annotated VCF file, one that has gene names and SnpEff annotations. there are a few that i …
ClinVar local install
written 10.3 years ago by win

Hi all. I want to do downstream analysis of VCF files and need to interface my data with ClinVar. I found ClinVar in VCF format …
Find Rs# From Vcf
written 12.6 years ago by win

Hi all, I have a set of rs#, about 1500 or so and what i want to do is query my annotated VCF files which …
How To Convert The Coordinates When Turning A Vcf File Into A Bed File
written 12.7 years ago by win

Hello all, I have a gVCF from Illumina and i want to slice out data from it. The is a list of SNP, some of …
Overlap Between Array And Vcf
written 12.8 years ago by win

Hi all, Hope someone can help. I have a tab delimited file of microarray data and a VCF file of the same sample. I want …
How To Programatically Obtain More Information On A Gene By Using Its Gene Symbol
written 13.3 years ago by win

hi all, hope someone can help. i have a list of gene symbols and i want to more info about that gene such as chromosome …
Bed File Coordinates
written 14.0 years ago by win

Hi all, In a spreadsheet i have my list of rs# with their chromosomal number and locations. I want to generate a BED file for …
Create A Tbi File From Vcf
written 14.1 years ago by win

hi all. i am generating a vcf file as the end result of my processing and i want to perform an interval query. since, tabix …