This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Post Assembly Gap Filling

Hi every one i am doing some plamid genome assembly with spades. After assembly i used SSPACE for scaffolding. But there are some gap each of the draft genome. I can fill the gap by PCR. But i want to reduce the number of gap insilico?? Can anyone suggest how to reduce the gap ?? If i do mapping the reads with contigs will it be give any promising result???

• 15,938 views • link
updated by appiahv • appiahv • written by HG HG

Hello @Boetsi

I used SSPACE-STANDARD to generate scaffold of my Salmonella typhi draft assembly. The only 'N' I found was on one contig as shown TAGAGAACCCTTCAATTGTTACGACAGGTCCAAATACTTCTTCTTGTACAATNCTCATAG

Is it still necessary for me to do gap filling?

• 0 views • link
written by appiahv • appiahv

Please do not add answers unless you're answering the top level question. I'm moving your "answer" to a comment.

• 0 views • link
written by Ram Ram

4 answers

There are a few in silico tools that can fill in the gaps within scaffolds;

GapFiller (developed by myself, I'm also the developer of SSPACE): http://www.baseclear.com/landingpages/basetools-a-wide-range-of-bioinformatics-solutions/gapfiller/ http://genomebiology.com/2012/13/6/R56

IMAGE2: http://sourceforge.net/apps/mediawiki/image2/index.php?title=Main_Page

GapCloser (part of SOAP): http://sourceforge.net/projects/soapdenovo2/files/GapCloser/

Regards, Boetsie

• 122 views • link
written by martenboetzer2 • martenboetzer2

Dear Boetsie

I've tried all three of the above programs, for GapCloser and IMAGE, report files indicated that no gaps are filled and Gap filler hangs then crashes on the first iteration. My assembly is Eukarytic, built with SPAdes, using PE and Minion reads. I am doing the gap closing with same PE reads used to assemble the genome. Is this why gap closing is failing? Are we supposed to use a different read library for the gap closing?

Thanks and kind regards Crystal

• 1 views • link
written by larvalanobium • larvalanobium

If you use paired reads you can take a look to: GapFiller

I haven't test it myself, though.

• 0 views • link
written by Biojl Biojl

GapCloser from SOAPdenono works perfect for me.
To use it, you will need paired-end or mate-pair reads.

• 0 views • link
written by Leszek Leszek

To run GapCloser from SOAP denovo , is it necessary to assemble with Soap denovo?? or else i can use different assembler. After that i can upload reads and contig ??? Currently i am using Spades 2.5.1

• 0 views • link
written by HG HG

no, as described in the program manual, you need assembly in fasta, reads in fastq or fasta and config file

• 0 views • link
written by Leszek Leszek

Your genome is circular, correct?

Your current assembly resulted in the entire genome as a scaffold with gaps (NNNs), but otherwise, your scaffold is circular, correct?

You can try iterative read mapping. You can do that either with CONSED (free) or Geneious (14 day free trial). When you map iteratively, each time an iteration is complete, the idea is that your contigs will be extended slightly. At one point, they should overlap. The bigger the read lengths, the faster you will be done.

• 0 views • link
written by Adrian Pelin Adrian Pelin

This is IMAGE2's strategy. See martenboetzer2's (Boetsie's) answer.

• 0 views • link
written by Lee Katz Lee Katz

Log in to answer this question.

More posts like this