Extract Upstream And Downstream Of User Defined Region From An Fasta File
I have two file ,one is fsata,the other file has defined information like below
query-id hit-id plus/minus start-site end-site query-sequence
234 chr1AL-k71-126309 1120 117769 + 30 55 GTCGCGAGAAGTCCATTGAACCTTAT
285 chr1AL-k71-126309 1120 117769 + 397 429 TGCGATACCTGGTGTGAATTGCAGAATCCCGCG
332 chr1AL-k71-126309 1120 117769 + 414 432 ATTGCAGAATCCCGCGAAC
5 chr1AL-k71-126309 1120 117769 + 423 452 TCCCGCGAACCATCGAGTCTTTGAACGCAA
121 chr1AL-k71-126309 1120 117769 + 430 447 AACCATCGAGTCTTTGAA
245 chr1AL-k71-126309 1120 117769 + 832 851 GCTTGAGAATCGGGCGGCTG
330 chr1AL-k71-126309 1120 117769 + 981 999 ACGAGTCGGGTTGTTTGGG
180 chr1AL-k71-126309 1120 117769 + 1075 1095 CGAGGGAAAGATGAAAAGGAC
309 chr1AL-k71-167040 262 977 + 131 151 CCTTTGTACACACCGCCCGTC
234 chr1AL-k71-167040 262 977 + 222 247 GTCGCGAGAAGTCCATTGAACCTTAT
I want to extract upstream and downstream 100bp (if upstream/downsteam length over than 100bp,else from the start/end site of hit sequence ).there is Sequence Subgroup Extractor,extract user defined region from an fasta file,who can change this or give a new?
• 5,731 views
•
link
1 answer
http://bedtools.readthedocs.org/en/latest/content/tools/getfasta.html
bedtools getfasta. To do the up and downstream, you may need bedtools flank and merge.
• 117 views
•
link
Log in to answer this question.
duplicate of Extract multiple fasta sequences from a file containing MANY sequences in lines and rows , how to extract specific coordinates from multifasta file
and more specifically: A: Get flanking sequence given a list of positions