Is It Possible To Extract Version Information Using The Ensembl Api · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Is It Possible To Extract Version Information Using The Ensembl Api

Hi,

Does anyone know if it's possible to extract version information using the ensembl API? Specifically, I'm trying to pull out the version of SIFT and polyphen-2 that has been used. I know this information is available in the documentation but was hoping to pull it out of our locally downloaded ensembl database to automatically account for updates.

Thanks

ensembl api

• 1,525 views • link

updated 12.9 years ago by Istvan Albert

• written 12.9 years ago by Simon •

0 answers

No answers yet.

Log in to answer this question.

More posts like this

GTEx sQTL v8 – annotation version used?
written 11 months ago by pedro.silvestre •

Hi everyone, I am currently working with the GTEx sQTL v8 dataset (available here: https://gtexportal.org/home/downloads/adult-gtex/qtl ). I’m trying to determine which annotation version (e.g., GENCODE/Ensembl …
Polyphen-2 for non-human organisms
written 2.2 years ago by Vitis

I've been looking at tools to predict variant effects in non-human organisms (other mammalian species). I'm aware of polyphen-2 and SIFT, and really need a …
How to extract repeat element coordinates from an Ensembl genome?
written 3.8 years ago by cchen635 •

I am trying to extract the repeat element coordinates, or bed specifically, from an Ensembl soft-masked fasta with format: >1 dna_rm:primary_assembly primary_assembly:bTaeGut1_v1.p:1:1:114557415:1 REF AAGCCAGCCATATCAGTATCCCAGCCGCGCAGGATCTGAGCGCCACCCAGCAATGGCCAG CCACTATGTGTGCCCCTGTATCACTGGAATTCAAGGCCCACCACCCTGTTCTCAGCCATA …
Getting external ids with Bio.KEGG.REST
written 6.5 years ago by laalice3 •

I want to work with a kegg pathway and need the ensembl IDs for the genes associated with this pathway. I am trying to do …
retrieve phyletic age of genes from ensembl database
written 11.0 years ago by erica.fary •

<p>Hi everyone,</p> <p>I need to retrieve the phyletic age (in million of years) of all the (protein-coding) genes for many organisms. I have been told …
Prediction Tools For Snps - Grantham Scores And Phylop
written 13.7 years ago by NB

<p>Hello,</p> <p>I am trying to prioritise my human SNP list based on prediction tools using grantham, phylop, SIFT and polyphen.</p> <p>But I am not able …
Music Source Code
written 13.8 years ago by sigven •

<p>Does anyone know whether it would be possible to obtain the source code of MuSIC so that we can compile it and run it locally …
A Quick Way To Match A List With Ensembl Gene Ids To The Specific Ensembl Db Version?
written 13.8 years ago by John Van Dam •

<p>Hi all,</p> <p>I received a list of ensembl genes (±1000) from a collaborator which I need to process. In order to do so I need …
How To Generate A Complete Human Chromosome From Ensembl With The Bioperl Ensembl Api
written 15.0 years ago by Simon •

<p>Hi, I would like to build an EMBL formated data for each human chromosome from Ensembl, using the associated perl API. Is this possible? I …
Retrieving All Available Frequency Data For A Snp Using Ensembl Api Tools
written 15.4 years ago by Krisr

<p>Hi,</p> <p>I would like to retrieve all available SNP population frequency data, for ~5000 SNPs. I have used the API perl variation tools to access …