What would be the most reliable means for using the oligo sequences used for a microarray to search a database for the targeted mRNA/gene? The arrays I have (Agilent) have relatively inconsistent annotation (multiple databases, if available) . I would like to avoid having to sew together multiple databases, especially since there is too much data to manually validate. I was considering BLAST but I don't know how consistent the results will be. Does anyone have suggestions on how to map expression array oligos to refseq mrna?
I was hoping to avoid R. I'm running into weirder problems after BLASTing.
For example:
TTTGATGGCTTCTTCTGCAGCTATAACCAAAAAGAACCTACACATTATAACTCAGGCCCA
Is linked to Ensembl transcript ENSMMUT00000018199 and NCBI protein NP_001177802.1. However, using either blastn or blastx, I am unable to locate anything in NCBI with the above oligo.
0 answers
No answers yet.
Log in to answer this question.
If you are lucky, bioconductor has an annotation database package for your specific chip type. Search in the bioconductor packages for agilent and you see a few annotation database packages (*.db)
Check the OP. I see the human and mouse arrays but nothing else I need.