What would be the most reliable means for using the oligo sequences used for a microarray to search a database for the targeted mRNA/gene? The arrays I have (Agilent) have relatively inconsistent annotation (multiple databases, if available) . I would like to avoid having to sew together multiple databases, especially since there is too much data to manually validate. I was considering BLAST but I don't know how consistent the results will be. Does anyone have suggestions on how to map expression array oligos to refseq mrna?
I was hoping to avoid R. I'm running into weirder problems after BLASTing.
For example:
TTTGATGGCTTCTTCTGCAGCTATAACCAAAAAGAACCTACACATTATAACTCAGGCCCA
Is linked to Ensembl transcript ENSMMUT00000018199 and NCBI protein NP_001177802.1. However, using either blastn or blastx, I am unable to locate anything in NCBI with the above oligo.
0 answers
No answers yet.
Log in to answer this question.
-
Getting Intron Positions from Amino Acid Sequences
written by fafad046 •
-
Stand alone Blast annotation with multiple databases
written by Biogeek
-
The best tips for performing local blastx with XML format output
written by seta
-
Microarray Study Design With Limited Replicates
written by pld
-
What Exactly Are The Ncbi Time Limits For Jobs Submitted From A Single Ip?
written by pld
-
Comparable E-Value Among Blast Programs
written by Damian Kao
-
Agilent Mouse 4X44K Gal/Probe Annotations
written by pld
-
Are The Query Strand And Hit Strand From Blastx The Same Strand?
written by David Maddison •
-
Ncbi Blast Output Missing Subject Name
written by Razzmataz •
-
Ucsc Genome Browser Does Not Locate Xm Genbanks: How To Overcome This?
written by Anima Mundi
If you are lucky, bioconductor has an annotation database package for your specific chip type. Search in the bioconductor packages for agilent and you see a few annotation database packages (*.db)
Check the OP. I see the human and mouse arrays but nothing else I need.