Biostar Beta. Not for public use.
What Is The Actual Illumina Smallrna Seq 3' Adapter
0
Entering edit mode
2.1 years ago
Bombay, India

This is the sequence of illumina small RNA seq 3' adapter as reported everywhere:

TCGTATGCCGTCTTCTGCTTGT

if i trim this adapter only 0.2% of all the reads are trimmed.

Just by casual observation I noticed that the sequence "TGTAGGCACCA" is present in the 3' of 50% of the reads. It is not the case with another sample.

Is there a standard adapter sequence? If not then is there a tool for finding any unknown adapter? biopieces find_adaptor doesnt look for all kinds of possible adapters.

illumina • 5.0k views
ADD COMMENTlink
0
Entering edit mode
16 months ago
Rm 7.8k
Danville, PA

Check the Kit you used for library preparation; We have "TGGAATTCTCGGGTGCCAAGG" as 3prime adapter sequence. Did you tried fastx tool kit for adapter clipping (fastx_clipper)?

ADD COMMENTlink
0
Entering edit mode

this is not my data.. i am doing analysis of a data which i downloaded from SRA.. yes I was using fastx_clipper, but the adapters vary from sample to sample..

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.3.1