This is the sequence of illumina small RNA seq 3' adapter as reported everywhere:
TCGTATGCCGTCTTCTGCTTGT
if i trim this adapter only 0.2% of all the reads are trimmed.
Just by casual observation I noticed that the sequence "TGTAGGCACCA" is present in the 3' of 50% of the reads. It is not the case with another sample.
Is there a standard adapter sequence? If not then is there a tool for finding any unknown adapter? biopieces find_adaptor doesnt look for all kinds of possible adapters.
•
written
by
Bharat Iyengar
this is not my data.. i am doing analysis of a data which i downloaded from SRA.. yes I was using fastx_clipper, but the adapters vary from sample to sample..
This is quite late but may be of use to someone like me down the road.
Eurofins published a list of adapters so maybe you can input the relevant ones into your trimming program; http://www.eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf
Best of luck.
Log in to answer this question.
