This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Looking For A Script To Reformat A Biological Data File

An example of the input and expected output format is below . Perhaps it's not a bioinformatic question, how can I convert it it with perl or awk?

miRNA_name    wsb1    wsb2    sm1    sm2    ph1    ph2    my1    my2
TCCCCACGGTCGGCGCCA    86    74    44    34    76    220    64    70
CGATTCCCCAGCGGAGTCGCCA    114    148    82    74    136    560    88    136
TTAGATGACCATCAGCAAACA    146    102    50    104    120    452    288    238
CTAATAGGGAACGTGAGCT    26    4    6    8    8    24    2    8
GATGCTTTGTGATTTGTGAATGCC    10    26    22    16    36    86    44    44

the result is 

TCCCCACGGTCGGCGCCA    
wsb1    86
wsb2    74
 sm1    44
 sm2    34
 ph1    76
 ph2    220
 my1    64
 my2    70
CGATTCCCCAGCGGAGTCGCCA    
 wsb1    114
 wsb2    148
  sm1    82
  sm2    74
  ph1    136
  ph2    560
  my1    88
  my2    136

.....

format perl awk
• 3,722 views • link
updated by Kenosis Kenosis • written by 2011101101 • 2011101101

This is not really a bioinformatics question, but a simple perl text processing question. someone might help you if you provide a little more information on the formats, the conversion is in fact very easy using perl and awk. What is the software requiring and yielding such formats? Also, it is impossible to see exactly what the formatting is from your example, because of the invisible delimiters in the output (tab,space, how many). If you provide this information, the question might be of some value for others searching for the same format conversion, otherwise it is not relevant and should be closed.

• 77 views • link
written by Michael Dondrup Michael Dondrup

yes , the format is not clear,I have edit it ,and I have get the answer by myself,use awk,it's very easy.thank you all the same,and how to close it ?

• 0 views • link
written by 2011101101 • 2011101101

Perhaps you would like to post your solution, so others may learn from it?

• 70 views • link
written by Neilfws Neilfws

I found your formatting and implicit specs clear and understandable. I see no good reason to close your question.

• 0 views • link
written by Kenosis Kenosis

3 answers

It is not entirely clear to me what you want to do with the file you have. But assuming you want to reshape the data in the file you specified on top and you want to reshape it in the way you specified than use R:

d <- read.table("yourFile.txt",sep="\t",header=T)

library(reshape) # if you don't have installed it use install.packages("reshape") first

d <- melt(d,id.vars="miRNA_name")

• 80 views • link
written by Irsan Irsan

Here's another Perl option:

use strict;
use warnings;

my @header = split ' ', <>;

while (<>) {
    my @line = /(\S+)/g;
    print "$line[0]\n";
    print "$header[$_]\t$line[$_]\n" for 1 .. @line - 1;
}

Usage: perl script.pl inFile [>outFile]

The last, optional parameter directs the output to a file.

Sample output on your dataset:

TCCCCACGGTCGGCGCCA
wsb1    86
wsb2    74
sm1    44
sm2    34
ph1    76
ph2    220
my1    64
my2    70
CGATTCCCCAGCGGAGTCGCCA
wsb1    114
wsb2    148
sm1    82
sm2    74
ph1    136
ph2    560
my1    88
my2    136
TTAGATGACCATCAGCAAACA
wsb1    146
wsb2    102
sm1    50
sm2    104
ph1    120
ph2    452
my1    288
my2    238
...

The header line is first split into @header. Then the subsequent file's lines are processed into array @lines, where $lines[0] contains the sequence that's printed as a header under which elements $header[1 .. n] are correspondingly printed with elements $line[1 .. n].

Hope this helps!

• 97 views • link
written by Kenosis Kenosis

Yes,this code is easy to me,and it's very help me to learn perl.

• 1 views • link
written by 2011101101 • 2011101101

This can be done using a perl 'Hash of Hash' and for a tab delimited data file 

use strict;
use warnings;
my %hoh=();
my $datafile="data.txt";
open FH,$datafile||die($!);
while(<FH>){
chomp $_;
my @fields=split(/\t/,$_);
$hoh{$fields[0]}{wsb1}=$fields[1];
$hoh{$fields[0]}{wsb2}=$fields[2];
$hoh{$fields[0]}{sm1}=$fields[3];
$hoh{$fields[0]}{sm2}=$fields[4];
$hoh{$fields[0]}{ph1}=$fields[5];
$hoh{$fields[0]}{ph2}=$fields[6];
$hoh{$fields[0]}{my1}=$fields[7];
$hoh{$fields[0]}{my2}=$fields[8];
}
close FH||die($!);
my @g_array=qw/wsb1 wsb2 sm1 sm2 ph1 ph2 my1 my2/;

for my $rna ( sort keys %hoh ) {
    print $rna,"\n";
    map{print $_,"\t",$hoh{$rna}{$_},"\n";}@g_array;
}
• 70 views • link
written by Woa Woa

Log in to answer this question.

More posts like this