This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Mapping One Repeat (37Pb) With Bwa/Maq

Hi all,

I'm playing with MAQ/BWA and I'm trying to map the following short read on chr22/hg19:

@repeat_1
GGTGTCTGGGACCAGAAAATAGTGAGGACCCTCTTAC
+
zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz

it should match twice at 

22   +   22678160  22678196
22   +   22759880  22759916

when I use GWA , the read is mapped at 51304531 (?? 51304531+37 = length(chr22) ???)

bwa aln -N chr22.fa chr22.sai repeat.fastq > chr22.sai
bwa  samse chr22.fa chr22.sai repeat.fastq
@SQ    SN:Chr22    LN:51304566
repeat_1    4    Chr22    51304531    0    37M    *    0    0    GGTGTCTGGGACCAGAAAATAGTGAGGACCCTCTTAC    zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz    XT:A:N    NM:i:27    XN:i:36X0:i:4    X1:i:0    XM:i:0    XO:i:0    XG:i:0    MD:Z:2A0T0C2A0T0C0C0T1G1G0C0C0T1C0C0A0C0C2T0T1G0C0A0A0C0T0A0

when I use MAQ, only one position was reported.

I'm sure I'm missing something here, help ! :-)

Many thanks, pierre

bwa next-gen sequencing mapping
• 5,471 views • link
updated by Ram Ram • written by Pierre Lindenbaum Pierre Lindenbaum

I compiled BWA for linux 32 bit (default is 64) . May be it's the source of the problem ?...

• 1 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

1 answer

Maq does not handle repeats, and will randomly report one of the mapped positions.

BWA has similar behavior by default, but the -R flag to aln will give you repeats.

Last time I checked, multiple hit reports are not in SAM format. For projects needing repeats, I normally use Bowtie.

For your question about the BWA output -- that SAM line indicates the read is unmapped. The easiest cue to pick up on is the 4 in the flag field. I'd expect it to give you one hit randomly assigned with either of those positions, so not sure why that is.

• 31 views • link
updated by Ram Ram • written by Brad Chapman Brad Chapman

hey what bowtie parameters do you use when mapping to repeat databases?

• 1 views • link
written by Jeremy Leipzig Jeremy Leipzig

@jeremy you can tell bowtie to report all mappings with --all or you can give an upper limit with -k (the default for -k is 1, so you only get the best hit).

• 1 views • link
updated by Ram Ram • written by brentp brentp

Log in to answer this question.

More posts like this