This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Docker image exceRpt pipeline help

I'm new to docker technology, I'm trying to run the exceRpt small RNA pipeline. I've pulled the image rkitchen/excerpt .

rkitchen/excerpt                           latest              38fceb372de2        2 years ago         2.02GB

I want to call on the image for each fastq file in my data directory so I have a file called runexrpt with the following contet:

   for i in /data/projects/0938_Feroz_Auyeung/test_fastq
do
    echo $i
    docker run -v /data/projects/0938_Feroz_Auyeung/test_fastq:/exceRptInput
 \
        -v /data/projects/0938_Feroz_Auyeung/excerptOuts_all:/exceRptOut
 \
        -v /data/genomes/exceRpt_hg38:/exceRpt_DB/hg38 \
        -t rkitchen/excerpt \
        INPUT_FILE_PATH=/exceRptInput/$(basename $i) \
        ENDOGENOUS_LIB_PRIORITY=miRNA,tRNA,gencode,piRNA,circRNA \
        MAIN_ORGANISM_GENOME_ID=hg38 \
        ADAPTER_SEQ=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
        N_THREADS=20 \
        JAVA_RAM=32G \
        MIN_READ_LENGTH=12 
done
echo "finished"

when I use docker run runexrpt it tells me that the image doesn't exist, I understand that the error arises because the image I have is rkitchen/excerpt, so my question is how would I run this image so that all my fastq files in the fastq folder are passed through the rkitchen/excerpt image? Do I make the above chunk of code into a new docker image using the docker build command and run that to make the container that will pass all fastq files into the pipeline and give me all their outputs?

any help/guidance would be appreciated, thank you!

docker small rna seq rnaseq excerpt

1 answer

Since you have included the docker run command in the shell script already, you will need to run it like this:

bash runexrpt

Log in to answer this question.