This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Getting the fasta format of a list of genes

Hello

If I have a list of genes

How I can get the fasta format of these like below?

>BC200
GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGAGCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACT
>NPPA
AS1TGCTGGTCAGAGGTCCTGGGGGTGGTTTTGAACCATCAGAGCTTGGACTTTTCTGACTTCCCCAGCAAGGATCTTCCCACTTCCTGCTCCCTGTGTTCCCACCC
genome fasta alignment

Have you tried bedtools getfasta -fi <genome_fasta> -bed <your_bed>?

Where in the code you are defining the lost of genes?

You have been on this forum long enough to know that you need to ask far more detailed questions than this.

What list of genes? What identifiers? Where do you want to get the sequences from? What organism? Do you know the genome?

From your comment, it seems you understand that you need a tool which can take the gene list - have you tried looking for such tools?

Yup, I definitely have tools that I can tell you about but I would want to know the things Joe has listed above, plus:

  • sequence type (cDNA/genomic/CDS)

  • number of IDs

Thank you so much

I have a list of long non coding RNA (lncRNA) and their possible target genes for human version hg19

There is a web tool http://www.cuilab.cn/lnctar which takes the fasta formats of lncRNA and their targets and say which genes is most likely is the target of a given lncRNA

I have the list of lncRNA and even their genomic coordinates however I am not sure if they are coding or not but I need the fasta format of these for the mentioned prediction tool

I have something like below in my hand

chr11   62619460    62623360    SNHG1
chr12   46777823    46781934    linc-FAM113B-3:copy2
chr7    26097439    26101262    linc-NPVF-2
chr1    28905050    28908366    SNHG12
chr1    212719036   212729407   linc-ATF3-2
chr17   74553846    74561430    SNHG16
chr1    173833039   173837125   GAS5
chr1    223354486   223361496   linc-C1orf65-1
chr1    76251879    76260775    RABGGTB
chr13   75811889    75814517    CTAGE11P
chr4    156127681   156129583   linc-FGG-1

Thank you for any help

At least this much information should have been in your opening post. Please don't make us tell you again.

How many lines in this file, approximately?

Thank you @ Emily_Ensembl In total I have 8000 lncRNA but only 200 of those were differentially expressed betwen two groups of patients for which I want to predict their target genes

1 answer

BioMart. Filter by your list of IDs, get the sequence as an attribute. Help video if you want to use the online tool, instructions if you'd rather use the R package.

Thanks a million

Could please look at this if I am doing right?

Attributes Sequence Unspliced (Gene) Gene name

enter image description here

if that's the sequence you want.

Thank you so much

Actually I want the nearby coding genes of lncRNAs excluding the gene with a distance of more than 100 kilobases upstream or downstream of ncRNAs.

Is this any filter to achieve this?

So you've received five comments and one answer from three different people, and now you tell us that your question is completely different to the one you asked originally?

I'm done. I'm going to change my notifications to Not Following for this post.

Log in to answer this question.