Penalise trailing gaps with Bowtie2. Assume forced end-toend

I would like to know what options I can use to Bowtie to to penalise this scenario

query......: | . | . | . | | | | | | | CAGCACTAGCGC | | | | | | | | | |

reference: ATCGATCGCTCAGCACTAGCGCTCAGCATCAG

(the dots are only to align the two sequenced, | represent effectively gaps in the start and end of the reference)

Over this scenario

query......: CAGCACTAGCGC

reference: CAGCACTAGCGC

Thanks

assembly sequencing sequence

• 637 views • link

written 5.5 years ago by anonymous •

0 answers

No answers yet.

More posts like this

Detection of chimeric HIV-Host transcripts
written 2.1 years ago by Mrist01 •

I am trying to detect the presences of chimeric HIV-host transcripts in my bulk RNA-seq datasets (single-end reads). The current protocols I have found online …
wgs supercontigs (NW_XXXXXX)
written 6.3 years ago by life99945 •

Hi, I have paired end reads which I mapped to a reference genome. This genome contains two types of contigs. First are contigs with NC …
Two questions about the MAFFT alignment tool.
written 6.3 years ago by josh.singer •

Two questions about MAFFT. (a) Suppose I have an unaligned nucleotide multi-fasta file A, with no gap ('-') characters, but it might contain any of …
BWA-MEM Syntax Understanding
written 7.8 years ago by ggman

Hey all, I am trying to switch over from bowtie to BWA. There are many options that I don't understand once you attempt to align …
How to use Minimap2 to aligne Pacbio reads over gaps in reference genome
written 8.3 years ago by williamsbrian5064

Hi, I have posted about this before and I got great responses! I was directed to use a program called Minimap2 to align Pacbio reads. …
Does samtools view only show reads that completely span the region?
written 8.3 years ago by Noam Teyssier

I've got a bam file of paired-end illumina sequences mapped to a reference sequence and I was wondering if when I call the samtools view …
Bowtie 2: bowtie build does not create .rev index files
written 9.5 years ago by dzisis1986 •

I am trying to run bowtie-build in Bowtie2 in order to create the index files for mapping and everytime i am running my script there …
difference between dash(-) and dot(.) in alignment representation
written 11.9 years ago by morteza.mahmoudisaber

I'm working with pairwise whole genome alignment and retrieved some data from Ensembl, in the data there two types of symbols '-' and '.' . …
Why does Blast report a different alignment when using the -m8 option
written 12.0 years ago by sebastian.f.ing •

I really need to know why when I do a blast with the option `-m8`, I have different results (different % identities, and gaps). example.. …
Quick Programming Challenge: How Do I Calculate Reference Coverage From A Table Of Alignment Starts…
written 16.3 years ago by Jeremy Leipzig

Imagine I have a reference sequence and some query sequences align to it length=|end-start|+1 when `end < start` the query sequence has aligned to the …