This is a test version of Biostars. For the public version, visit https://www.biostars.org.
difference between dash(-) and dot(.) in alignment representation

I'm working with pairwise whole genome alignment and retrieved some data from Ensembl, in the data there two types of symbols '-' and '.' . for example in this alignment:

http://www.ensembl.org/Homo_sapiens/Location/Compara_Alignments?align=714&db=core&g=ENSG00000184029&r=21%3A37951425-37973764

i think '-' represent gaps but i dont know what dots represent. in the example above there are dots in the vicinity of the sequence 'TTTAAAGAGAATATCCTTGTTCTTAGTAAATATGCCTT'

I appreciate if anybody could help me here

ensembl alignment
• 16,430 views • link
updated by Ram Ram • written by morteza.mahmoudisaber morteza.mahmoudisaber

maybe it points towards an insertion or deletion?

• 0 views • link
written by Phil S. Phil S.

1 answer

Answer by Ensembl Helpdesk:

In this view:

http://www.ensembl.org/Homo_sapiens/Location/Compara_Alignments?align=688--pan_troglodytes--17:62917953-63020080;db=core;r=17:64155265-64255264

dashes ('-') represent gaps in the sequence of one genome relative to its counterpart in the pairwise view. You can think of them as indels (insertions/deletions when comparing the genomes).

The dots are to represent that we were unable to find a match in that given region and this can be due to several region s such as the genome is fragmented (therefore regions are missing) or the match did not pass our threshold so we have not showed them in the alignment...

This information should be in the help page of that view:

http://www.ensembl.org/Help/View?id=202

We will be updating it for the next release.

• 1 views • link
updated by Ram Ram • written by morteza.mahmoudisaber morteza.mahmoudisaber

Log in to answer this question.

More posts like this