Hi I am trying to align a fastq file to mitochondrial genome with bowtie 2 with the following command and store unmapped read to folder unaligned

 bowtie2 -p 1 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /home/ptaklifi/genome_folder/rCRSd/bowtie2_index/default/rCRSd --rg-id SRR10984460 -U SRR10984460_1-trimmed-pair1.fastq --un unaligned

but during alignment I get this error

Error: Read SRR10984461.33749887 33749887 length=76 has more read characters th$
terminate called after throwing an instance of 'int'
Aborted (core dumped)
(ERR): bowtie2-align exited with value 134

using the command below I looked through the read

 grep SRR10984461.33749886 -A 3 SRR10984461_1-trimmed-pair1.fastq

and here is the output :

ATTCAAACAAGTACAATTAGAAATTATAAAGGTGACATTAACAACTCATATCACAGAAATACAAAAGATCATCAGA
+
A

so first should I delete this read ? and if so, how to do that ? I appreciate your response