error with bowtie2 alignment
Hi
I am trying to align a fastq file to mitochondrial genome with bowtie 2 with the following command and store unmapped read to folder unaligned
bowtie2 -p 1 -k 1 -D 20 -R 3 -N 1 -L 20 -i S,1,0.50 -x /home/ptaklifi/genome_folder/rCRSd/bowtie2_index/default/rCRSd --rg-id SRR10984460 -U SRR10984460_1-trimmed-pair1.fastq --un unaligned
but during alignment I get this error
Error: Read SRR10984461.33749887 33749887 length=76 has more read characters th$
terminate called after throwing an instance of 'int'
Aborted (core dumped)
(ERR): bowtie2-align exited with value 134
using the command below I looked through the read
grep SRR10984461.33749886 -A 3 SRR10984461_1-trimmed-pair1.fastq
and here is the output :
ATTCAAACAAGTACAATTAGAAATTATAAAGGTGACATTAACAACTCATATCACAGAAATACAAAAGATCATCAGA
+
A
so first should I delete this read ? and if so, how to do that ? I appreciate your response
• 1,824 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Use
cutadaptto filter out low-quality bases/reads.Soemthing got corrupted during the initial trimming would be my guess. How did you do the trimming?
That looks about right. Can you check whether this is already in the original fastq file you downloaded? You could run repair.sh from BBMap on the original file, then trim and proceed if the original file was the problem.
I downloaded the fastq files from SRA . I will check if the problem is with fastq files. Thank you
thank you @ATpoint . as suggested , I think I should remove poor quality reads in trimming step. can I remove them with skewer ?