This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bowtie2 - (ERR): bowtie2-align exited with value 13

I am trying to run bowtie2. but following error are occuring everytime

bowtie2 --very-fast-local -x bowtie -q -1 R1.fastq -2 R2.fastq  -s aligned.sam
Saw ASCII character 10 but expected 33-based Phred qual.
terminate called after throwing an instance of 'int'
Aborted (core dumped)
(ERR): bowtie2-align exited with value 134
bowtie2
• 2,967 views • link
updated by ATpoint ATpoint • written by saifulislam99121 • saifulislam99121

Why have you got -x bowtie?

What is the output of:

head R1.fastq
zcat R1.fastq | head
• 0 views • link
written by Kevin Blighe Kevin Blighe

-x bowtie, here bowtie is my index name.

head R1.fastq
@NB501155:17:HFVMTAFX3:1:11101:23243:1106 1:N:0:GATTCTGAAT+GTCCACCGCT
TTGCTAAAGTTCAGATCTTGATAAAAGACATTAGAAATCACACCAGCAATAATGTCTGAAATACGGAAGAACCCAATCAAGAATAGAAGTACTAAGGCAAGTTTGACACCATAACGTTTAAAGAAATCCAGAATTGGTGAAATCCAAGT
+
AAAAA/EEEEE/EEEEEEEEEE/EEEAEEEEEEEEEEA/E/EA/EE/EEE/AEEEEEEEEAEAEE/E<AAAAE6EAEAEEAEEEE/EEAEE/AAEE/<EEEA/E<E/E//<EAEA<EEEA//<EEEEA/</EEEE/E///E/</6AE<E
@NB501155:17:HFVMTAFX3:1:11101:4115:1116 1:N:0:GAATCTGAAT+GTCCACCGCT
AATCAATGCCGTATTTGGTTTTAAATGCATGAAAAACAGCAGCTTTTAAAATTGGATTTTCACTTGCAGCAACTTTACCCACTACACGACTTAACTGATGCTGAGGAACAAGATTTTGTGCCTTAATAAATAATTCTTTTTTTAAGCGA
+
AAAAAEEEEEEAEEEEEE/EEEEEEE/EEAEEE/EEEEEEEE<E//E/EEEE/E/EE<E/EEE</EAE/AEEEAE/AA<<AEE<AAAEAE6EAEE//EEAEE//E/EEEEEEE/EE/<A<<AA/6EAAEEA<E//AEEEAEE/AAA/A<
@NB501155:17:HFVMTAFX3:1:11101:9798:1117 1:N:0:GATTCTGAAT+GTCCACCGCT
GTTTTACCTAAACCTACTTCATCAGCAAGTAAAACACGTGGTGCGAAACGTTTACCGACTTCATGTGCAATATAAAGCTGATGCGGAATTAAACCTACACGAGCCCCAACCAAGCCGCGTAATGGGCTGGTTTGCATTTGCGCCTGCAT
zcat R1.fastq | head

gzip: R1.fastq: not in gzip format

Here is the output.

• 0 views • link
updated by Kevin Blighe Kevin Blighe • written by saifulislam99121 • saifulislam99121

1 answer

It sounds like some of the lines are of unequal length between the sequence and quality records. That is why ASCII character 10 (end-of-line) is encountered while the expectation was it would be a 33-based Phred quality value. I suggest you try fixing the files with repair.sh which is part of the BBtools package.

• 0 views • link
written by Mensur Dlakic Mensur Dlakic

Also note that -s (lowercase) is not the option for saving a SAM file, that would be uppercase -S, bet better would be to save as BAM right away, bowtie2 -x (...) | samtools view -o your.bam

• 0 views • link
written by ATpoint ATpoint

Log in to answer this question.

More posts like this
  • Bowtie2 Error: reads file does not look like a FASTQ file
    written by SO_Bio • SO_Bio
    Hi, I need your help. I am using this code and bowtie sends me this error. Thank you ``` bowtie2 -x /home/anam/HumanGenome/HomoGenbt2/HumanGenome -1 14iadR1_forward_paired.fastq -2 …
  • Error 134 while aligning using hisat2
    written by Ngrin • Ngrin
    Hello, I am using the below command to align the reads and get bam file: ``` hisat2 -x /hisat/grch38/genome -1 /fastq/output_forward_paired.fq.gz -2 /fastq/output_reverse_paired.fq.gz | samtools …
  • I need help with bowtie2 to map reads different length
    written by DByter • DByter
    Hi, I need help mapping Paired-end samples. My samples were filtered by Prinseq. But after the filter, this error appears: ``` Error, fewer reads in …
  • Abnormal fastq lines
    written by jaqx008 jaqx008
    Hello all, I obtained this SRA files from ncbi. Something appears to be off with the third lines and I am not sure what but …
  • Error while using bowtie2
    written by Jimpix • Jimpix
    Hello! After typing command below: bowtie2 -x Sequence/Bowtie2Index/genome -1 A1.fastq -2 A2.fastq -S A.sam I've got an error: Error, fewer reads in file specified with …
  • Bowtie2 Alignment Error
    written by chaudharyc61 • chaudharyc61
    Hi I'm aligning Paired-end data using `bowtie2` aligner and got this error: Error, fewer reads in file specified with -2 than in file specified with …
  • Bowtie 2 error?
    written by star star
    I have run Bowtie2 for aligning ChIP-seq data and in one data I faced the below error `Error: Read SN7001318:103:H86L8ADXX:2:2102:16521:69527 1:N:0:8 has more read characters …
  • Error while running HISAT2
    written by rob.costa1234 rob.costa1234
    I have paired end RNAseq data that has been trimmed individual AFSTq file, when I ran hisat2 it gives me following error- Error, fewer reads …
  • align fasta files using bowtie2
    written by marongiu.luigi marongiu.luigi
    dear all, it is possible to use bowtie2 to align fasta files rather than fastq? essentially I would like to use bowtie just like an …
  • Bowtie2 character encoding error
    written by Medhat Medhat
    I am running bowtie2 for mate pairs specifying this parameter: bowtie2 --local --phred64 --threads 25 -x "rest of the command" It gives me this error: …