is there any solution to convert a multifasta file to csv?
1 answer
This should get you going:
from Bio import SeqIO
for re in SeqIO.parse('CHIKV1-X-gb_AB455493.fasta', 'fasta'):
print('>{}\t{}'.format(str(re.description).replace('|', '\t'), re.seq))
Prints out:
>gb:KX262887 Organism:Zika virus Strain Name:103451 Segment:null Subtype:Asian Host:Human GTTGTTGATCTGTGTGAATCA ....
>gb:KX262887 Organism:Zika virus Strain Name:103451 Segment:null Subtype:Asian Host:Human GTTGTTGATCTGTGTGAATCA ....
>gb:KX262887 Organism:Zika virus Strain Name:103451 Segment:null Subtype:Asian Host:Human GTTGTTGATCTGTGTGAATCA ....
The rest is simply a matter of possibly using comma instead of tab.
• 0 views
•
link
written
by
Mensur Dlakic
Log in to answer this question.
More posts like this
-
fasta to stockholm
written by saadleeshehreen
-
Convert Plink to Arlequin
written by HG •
-
SILVAngs -> biom.format -> data.visualization
written by tomaz-biostars •
-
GenPept(.gp) file to (.csv) excel file conversion
written by easyshortcatchy •
-
splitting Multifasta File Into A *Smaller Multifasta File containing few sequence
written by kabir.deb •
-
Split multifasta file in individual sequence file
written by tcf.hcdg
-
LDHAT pairwise analysis to test for recombination
written by ch_at •
-
Csplit Multifasta File Into A *Smaller Multifasta File
written by neal.platt
-
How To Change The Alphabet Of Seqrecords In A Fasta File With Biopython?
written by Laura •
-
Using Ruby To Convert Csv File To Fasta
written by User 7433 •
What on earth is a multi-folder file? Given that your header is in a custom format, you're going to have to parse it using custom code.
Multifasta - with many sequences fasta. I'm going to edit sorry. Is there any solution?
You're halfway there.
re.id + redescriptionshould give you the whole header, make sure of that. Once you have it, you can split by|and then spit each element of that by:into key value pairs. Then, these key value pairs along withre.seqwill give you the columns for eachre. Write these attributes separated by,and you'll have your CSV.Thanks!!!