The script to which you link assumes that you are using a Linux-like operating system. So it has the lines:

csv_file    = "#{ENV['HOME']}/path_to_csv_file.csv"
fasta_file  = "#{ENV['HOME']}/path_to_fasta_file.fasta"

ENV['HOME'] is a special Ruby variable. If your user name was "bob", for example, then Ruby would interpret the lines above as:

/home/bob/path_to_csv_file.csv
/home/bob/path_to_fasta_file.fasta

But the person who wrote that script is using a shorthand. They do not mean that the files should start with "path_to_". They mean that you must specify the full path to the input CSV file and the output FASTA file. So if you want those files, for example, to be in /home/bob/projects/conversion, then you would write:

csv_file    = "#{ENV['HOME']}/projects/conversion/input.csv"
fasta_file  = "#{ENV['HOME']}/projects/conversion/output.fasta"

To make the script work, you would use a plain text editor to write the code, save it with a sensible name such as csv2fasta.rb and then run (in the same directory where you saved the Ruby script):

ruby csv2fasta.rb

And the file output.fasta should appear in /home/bob/projects/conversion.

Unfortunately if you are using Windows, none of the above applies because file paths are completely different. So it is probably best to try:

csv_file    = "input.csv"
fasta_file  = "output.fasta"

Then save the Ruby script in the same directory as input.csv and make sure that you run the script from that same directory.

But remember that Ruby is only one possible solution and that code you find on the web is not always the best code.

Neil's comments are absolutely true and worth keeping in mind for the future.

However, if your csv file is just two columns [name,sequence] you probably doesn't need a whole script. If you're input file looks like this:

chrom_1,CATCGTAGCTAGTCGACTATGCTAGCTAGC
chrom_2,CTGATGCTAGCTACTGACTGACTGATCGATCTAGCTA
chrom_3,ATGCTGACTGATCGTACTGATCGTGACTGCTGAC

Then all you need to do (replace seqs.csv with your csv filename) is start a terminal session (Windows -> run and type "cmd"). Change into the directory that contains your sequences (use the "cd" command) and run:

ruby -ne 'puts ">" + $_.split(",").first(2).join("\n")' seqs.csv

This will give the output:

>chrom_1
CATCGTAGCTAGTCGACTATGCTAGCTAGC
>chrom_2
CTGATGCTAGCTACTGACTGACTGATCGATCTAGCTA
>chrom_3
ATGCTGACTGATCGTACTGATCGTGACTGCTGAC