This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to trim reads when I'm not sure where they are?

Hello everyone!

We did a RNAseq paired end with 150 bp in NovaSeq with TruSeq Total RNA strandred, with an external supplier. I'm now trying to analyze the data but I'm having trouble with the adaptors

They sent me the following sequences:

"

P7: GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCAGATTATCTCGTATGCCGTCTTCTGCTTG

P5: AGATCGGAAGAGCGTCGTGTAGGGAAAGA

"

But I'm not entirely sure how I should use this in cutadapt

With the manual of illumina (https://support.illumina.com/bulletins/2016/04/adapter-trimming-why-are-adapter-sequences-trimmed-from-only-the--ends-of-reads.html), I should remove both of them in the 3', but I'm not sure if p7 is for read 1 and p5 is for read 2, if I should remove both adapters from both ends of read 1 and 2 etc.

Maybe I should ask them, but I want to be sure what I need to ask so I can obtain the correct answer

Also, is it bad to remove both sequences from both ends of the 2 reads? Why?

rna-seq cutadapt illumina
• 1,915 views • link
updated by shelkmike shelkmike • written by avelarbio46 • avelarbio46

2 answers

In illumina reads you should only see adapter sequence at the 3'-end of the reads. This will happen if you have short inserts and sequencing reads through those.

Would like to point out an easy alternative to cutadapt. You can use bbduk.sh from BBmap suite for the same purpose. A guide is available here. Program comes with a comprehensive set of adapter sequences for most commercial kits that you will find in the resources directory of the download.

• 0 views • link
written by GenoMax GenoMax

I recommend to use fastp. It is able to automatically guess adapter sequences in your reads and trim them, you don't even have have to know which adapters are in your reads.

• 0 views • link
written by shelkmike shelkmike

Log in to answer this question.

More posts like this