bowtie2 making new indices
Hi, I have a sequence which includes a transposon along with a gRNA
>TE
TGTATGTAAACTTCCGACTTCAACTGTA
I want to find this in my sample fastq files. I made an index using Bowtie2:
bowtie2-build /home/usr/Desktop/client/TE_pattern.fna TE_human
then aligned the sample fastq files to it:
bowtie2 -x /home/usr/sb_human -1 1.fq.gz -2 2.fq.gz --sensitive-local -S TE_align.sam
I can see the transposon in the SAM file , but since the pattern I had put contains the header >TE, now I cannot do anything for downstream processing as they do not contain the typical BED like format (bamtobed) to facilitate extraction of the genomic intervals. How do I build an index which can facilitate this? Kindly advise. regards.
• 1,232 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Can you please elaborate on what the problem is? I don't understand. This is the standard way of building an index.
The transposon and the gDNA are seen in the SAM file, but downstream processing of the SAM file into BAM and BAM to BED does not result into the chromosome numbers. It looks like this chr 123 456 So while the reads are being retrieved in the SAM files, I cannot trace the genomic coordinates.
Are you simply interested in finding reads that contain this sequence or are you looking to identify locations where this transposon has inserted itself?
Primarily the genomic locations where the transposon has inserted