This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bowtie2 making new indices

Hi, I have a sequence which includes a transposon along with a gRNA 

>TE
TGTATGTAAACTTCCGACTTCAACTGTA

I want to find this in my sample fastq files. I made an index using Bowtie2:

bowtie2-build /home/usr/Desktop/client/TE_pattern.fna TE_human

then aligned the sample fastq files to it:

bowtie2 -x /home/usr/sb_human -1 1.fq.gz -2 2.fq.gz --sensitive-local -S TE_align.sam

I can see the transposon in the SAM file , but since the pattern I had put contains the header >TE, now I cannot do anything for downstream processing as they do not contain the typical BED like format (bamtobed) to facilitate extraction of the genomic intervals. How do I build an index which can facilitate this? Kindly advise. regards.

bowtie2 new indices
• 1,231 views • link
written by amitpande74 • amitpande74

Can you please elaborate on what the problem is? I don't understand. This is the standard way of building an index.

• 0 views • link
written by ATpoint ATpoint

The transposon and the gDNA are seen in the SAM file, but downstream processing of the SAM file into BAM and BAM to BED does not result into the chromosome numbers. It looks like this chr 123 456 So while the reads are being retrieved in the SAM files, I cannot trace the genomic coordinates.

• 0 views • link
written by amitpande74 • amitpande74

I want to find this in my sample fastq files.

Are you simply interested in finding reads that contain this sequence or are you looking to identify locations where this transposon has inserted itself?

• 0 views • link
written by GenoMax GenoMax

Primarily the genomic locations where the transposon has inserted

• 0 views • link
written by amitpande74 • amitpande74

0 answers

No answers yet.

Log in to answer this question.

More posts like this